Incidental Mutation 'R1875:Ddah2'
ID211188
Institutional Source Beutler Lab
Gene Symbol Ddah2
Ensembl Gene ENSMUSG00000007039
Gene Namedimethylarginine dimethylaminohydrolase 2
SynonymsClone 7u, G6a, NG30, Ddah
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35059035-35062095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35060845 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 137 (F137S)
Ref Sequence ENSEMBL: ENSMUSP00000134072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007255] [ENSMUST00000007257] [ENSMUST00000097337] [ENSMUST00000173207] [ENSMUST00000173520] [ENSMUST00000174190] [ENSMUST00000174493]
Predicted Effect probably damaging
Transcript: ENSMUST00000007255
AA Change: F137S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007255
Gene: ENSMUSG00000007039
AA Change: F137S

DomainStartEndE-ValueType
PDB:2JAJ|B 1 282 1e-77 PDB
SCOP:d1h70a_ 13 277 1e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007257
SMART Domains Protein: ENSMUSP00000007257
Gene: ENSMUSG00000007041

DomainStartEndE-ValueType
Pfam:GST_N_3 21 92 4.8e-11 PFAM
Pfam:GST_N_2 23 87 3.3e-10 PFAM
Pfam:GST_C_2 123 212 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097337
SMART Domains Protein: ENSMUSP00000094950
Gene: ENSMUSG00000073414

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 20 121 3.27e0 SMART
low complexity region 145 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173207
SMART Domains Protein: ENSMUSP00000134194
Gene: ENSMUSG00000092586

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Blast:LU 48 136 3e-57 BLAST
low complexity region 139 151 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173520
AA Change: F137S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134595
Gene: ENSMUSG00000007039
AA Change: F137S

DomainStartEndE-ValueType
Pfam:Amidinotransf 28 157 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173562
Predicted Effect probably benign
Transcript: ENSMUST00000174190
SMART Domains Protein: ENSMUSP00000133377
Gene: ENSMUSG00000073414

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 20 121 3.27e0 SMART
low complexity region 145 160 N/A INTRINSIC
low complexity region 168 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174493
AA Change: F137S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134072
Gene: ENSMUSG00000007039
AA Change: F137S

DomainStartEndE-ValueType
Pfam:Amidinotransf 30 232 5e-27 PFAM
Meta Mutation Damage Score 0.9431 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dimethylarginine dimethylaminohydrolase. The encoded enzyme functions in nitric oxide generation by regulating the cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. The protein may be localized to the mitochondria. Alternative splicing resulting in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice exhibit normal embryonic survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Ddah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Ddah2 APN 17 35060631 missense possibly damaging 0.89
IGL02704:Ddah2 APN 17 35061007 missense possibly damaging 0.94
IGL02949:Ddah2 APN 17 35061800 missense probably damaging 0.97
R1196:Ddah2 UTSW 17 35061527 missense probably damaging 1.00
R2018:Ddah2 UTSW 17 35060426 missense possibly damaging 0.57
R2225:Ddah2 UTSW 17 35060211 missense probably damaging 1.00
R2245:Ddah2 UTSW 17 35061585 missense probably damaging 1.00
R5826:Ddah2 UTSW 17 35060688 missense probably damaging 1.00
R7652:Ddah2 UTSW 17 35061050 missense possibly damaging 0.91
X0018:Ddah2 UTSW 17 35060667 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCCAAGGTTGATGGAGTGCG -3'
(R):5'- GTTGAGACAGCGAAGTCCTAG -3'

Sequencing Primer
(F):5'- CAGGACTTGGGACTCCGAATTG -3'
(R):5'- CAGCGAAGTCCTAGAAGAGC -3'
Posted On2014-06-30