Incidental Mutation 'R1876:Ak1'
ID211200
Institutional Source Beutler Lab
Gene Symbol Ak1
Ensembl Gene ENSMUSG00000026817
Gene Nameadenylate kinase 1
SynonymsAk-1, B430205N08Rik
MMRRC Submission 039898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R1876 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32621758-32635058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32630270 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 27 (K27E)
Ref Sequence ENSEMBL: ENSMUSP00000108903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068271] [ENSMUST00000113277] [ENSMUST00000113278] [ENSMUST00000156578] [ENSMUST00000195721]
Predicted Effect probably damaging
Transcript: ENSMUST00000068271
AA Change: K43E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068479
Gene: ENSMUSG00000026817
AA Change: K43E

DomainStartEndE-ValueType
Pfam:AAA_33 26 173 2.7e-10 PFAM
Pfam:AAA_17 26 194 5.4e-8 PFAM
Pfam:ADK 29 185 1.3e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113277
AA Change: K27E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108902
Gene: ENSMUSG00000026817
AA Change: K27E

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113278
AA Change: K27E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108903
Gene: ENSMUSG00000026817
AA Change: K27E

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135392
Predicted Effect possibly damaging
Transcript: ENSMUST00000156578
AA Change: K27E

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123534
Gene: ENSMUSG00000026817
AA Change: K27E

DomainStartEndE-ValueType
Pfam:AAA_17 10 86 1.5e-10 PFAM
Pfam:ADK 13 89 3.5e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195721
AA Change: K22E

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142174
Gene: ENSMUSG00000026817
AA Change: K22E

DomainStartEndE-ValueType
Pfam:ADK 13 96 2e-32 PFAM
Meta Mutation Damage Score 0.5224 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adenylate kinase enzyme involved in energy metabolism and homeostasis of cellular adenine nucleotide ratios in different intracellular compartments. This gene is highly expressed in skeletal muscle, brain and erythrocytes. Certain mutations in this gene resulting in a functionally inadequate enzyme are associated with a rare genetic disorder causing nonspherocytic hemolytic anemia. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased adenosine triphosphate (ATP) turnover and reduced efficiency of ATP utilization during muscle contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,877,549 C961F probably damaging Het
Abca16 A C 7: 120,433,385 D209A probably damaging Het
Adamts14 T C 10: 61,200,372 I1047V probably benign Het
Akap9 T A 5: 3,961,809 D837E probably benign Het
Arfgef3 T C 10: 18,597,356 Y1653C probably damaging Het
Atad2 T G 15: 58,106,868 I446L probably benign Het
Atp8b3 T G 10: 80,530,078 T313P possibly damaging Het
Btg4 T C 9: 51,117,189 L72S probably damaging Het
Canx A G 11: 50,304,359 I294T probably damaging Het
Casp1 G A 9: 5,303,663 E250K probably benign Het
Chchd10 T A 10: 75,936,332 S46T probably benign Het
Col12a1 G T 9: 79,678,281 Y1271* probably null Het
Col3a1 G A 1: 45,342,235 probably null Het
Ctc1 A T 11: 69,031,564 T872S probably benign Het
Cx3cl1 T C 8: 94,780,420 F351S probably damaging Het
Cyb5r4 T A 9: 87,055,814 H295Q probably damaging Het
Cyp2j7 T C 4: 96,217,419 T285A probably benign Het
Dip2a G A 10: 76,318,091 T135M probably damaging Het
Fgf10 A G 13: 118,789,159 E158G probably damaging Het
Ftcd G T 10: 76,581,569 A281S probably benign Het
Gm16368 T G 12: 88,084,040 I115S probably damaging Het
Gpat4 A T 8: 23,179,470 M333K possibly damaging Het
Gpcpd1 A G 2: 132,534,753 L541P probably damaging Het
Grk5 T C 19: 61,083,225 Y408H probably damaging Het
Hcrtr2 A G 9: 76,246,345 probably null Het
Hsd17b13 T A 5: 103,968,767 N127I probably damaging Het
Hspa4 T G 11: 53,284,156 D158A probably benign Het
Ice2 G A 9: 69,415,575 A451T possibly damaging Het
Inpp5e A T 2: 26,408,157 I144K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc49 T C 9: 60,587,777 I652V possibly damaging Het
Man1a A T 10: 53,919,172 W571R probably damaging Het
Mecom A G 3: 29,993,658 S32P probably damaging Het
Mrpl40 A G 16: 18,872,474 I162T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T C 15: 12,257,630 W265R probably damaging Het
Mup21 C T 4: 62,149,426 V79I probably benign Het
Myh11 G A 16: 14,269,103 probably benign Het
Myom3 T A 4: 135,779,400 F495I probably benign Het
Ncoa7 A T 10: 30,698,126 probably benign Het
Nisch T C 14: 31,173,637 Y45C probably damaging Het
Nkain2 T A 10: 32,890,439 probably benign Het
Olfr356 A T 2: 36,937,763 I215F possibly damaging Het
Olfr728 A G 14: 50,140,172 S156P probably damaging Het
Pdcl A C 2: 37,355,696 H98Q probably damaging Het
Pink1 A G 4: 138,315,702 V427A probably damaging Het
Plce1 T C 19: 38,780,623 S2242P probably damaging Het
Plrg1 C A 3: 83,069,068 probably benign Het
Plxnc1 A G 10: 94,866,941 F586S possibly damaging Het
Pnpla7 G A 2: 25,040,973 V867M possibly damaging Het
Ppfia3 T A 7: 45,352,207 D427V possibly damaging Het
Ppp6r3 A T 19: 3,471,971 probably benign Het
Pros1 A T 16: 62,903,518 S210C probably damaging Het
Ptk2b A G 14: 66,158,392 S839P probably benign Het
Ptpre T C 7: 135,678,317 V570A possibly damaging Het
Rbm48 C T 5: 3,595,259 A142T probably damaging Het
Safb2 T C 17: 56,576,909 probably null Het
Scnn1a A G 6: 125,338,838 E384G probably benign Het
Sec23ip A G 7: 128,752,851 Y277C probably benign Het
Slc25a29 G A 12: 108,827,711 T42M probably damaging Het
Slc6a4 A T 11: 77,015,164 T264S probably benign Het
Srgap3 A G 6: 112,775,566 M319T probably damaging Het
Strn4 T A 7: 16,838,282 I640N probably damaging Het
Tacc2 A G 7: 130,623,745 D739G probably benign Het
Tigd4 T A 3: 84,593,935 L53* probably null Het
Tlr6 T A 5: 64,955,420 D48V probably damaging Het
Tmem125 T C 4: 118,541,904 D110G probably damaging Het
Tmem198 A G 1: 75,484,923 D341G probably damaging Het
Tnfaip3 A G 10: 19,004,934 F462L possibly damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ush2a T A 1: 188,678,289 I2378N possibly damaging Het
Usp47 A G 7: 112,054,920 T108A probably damaging Het
Vmn1r236 T A 17: 21,286,638 I6K probably benign Het
Vmn2r65 A T 7: 84,946,297 V393D probably damaging Het
Other mutations in Ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Ak1 APN 2 32633495 unclassified probably benign
R1472:Ak1 UTSW 2 32630301 missense probably damaging 1.00
R1476:Ak1 UTSW 2 32633466 missense probably benign
R2004:Ak1 UTSW 2 32629610 missense probably benign
R4067:Ak1 UTSW 2 32629581 missense probably benign 0.05
R4246:Ak1 UTSW 2 32633372 missense possibly damaging 0.54
R4873:Ak1 UTSW 2 32631177 missense probably benign 0.28
R4875:Ak1 UTSW 2 32631177 missense probably benign 0.28
R5076:Ak1 UTSW 2 32633448 missense probably damaging 1.00
R6187:Ak1 UTSW 2 32633477 missense probably damaging 0.99
R6458:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6818:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6917:Ak1 UTSW 2 32631152 missense possibly damaging 0.86
R6919:Ak1 UTSW 2 32631122 missense possibly damaging 0.62
Z1088:Ak1 UTSW 2 32630271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGGGTCTGAGGGTCTG -3'
(R):5'- TGGAGAATGGCTGACCCCTG -3'

Sequencing Primer
(F):5'- GTCCTGAAACTCACTGTGTAGAC -3'
(R):5'- CATGATAGCCGACAGCTT -3'
Posted On2014-06-30