Incidental Mutation 'R1876:Kirrel'
ID211207
Institutional Source Beutler Lab
Gene Symbol Kirrel
Ensembl Gene ENSMUSG00000041734
Gene Namekirre like nephrin family adhesion molecule 1
SynonymsKirrel1, 6720469N11Rik, Neph1
MMRRC Submission 039898-MU
Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1876 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87078593-87174747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87089151 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,877,549 C961F probably damaging Het
Abca16 A C 7: 120,433,385 D209A probably damaging Het
Adamts14 T C 10: 61,200,372 I1047V probably benign Het
Ak1 A G 2: 32,630,270 K27E probably damaging Het
Akap9 T A 5: 3,961,809 D837E probably benign Het
Arfgef3 T C 10: 18,597,356 Y1653C probably damaging Het
Atad2 T G 15: 58,106,868 I446L probably benign Het
Atp8b3 T G 10: 80,530,078 T313P possibly damaging Het
Btg4 T C 9: 51,117,189 L72S probably damaging Het
Canx A G 11: 50,304,359 I294T probably damaging Het
Casp1 G A 9: 5,303,663 E250K probably benign Het
Chchd10 T A 10: 75,936,332 S46T probably benign Het
Col12a1 G T 9: 79,678,281 Y1271* probably null Het
Col3a1 G A 1: 45,342,235 probably null Het
Ctc1 A T 11: 69,031,564 T872S probably benign Het
Cx3cl1 T C 8: 94,780,420 F351S probably damaging Het
Cyb5r4 T A 9: 87,055,814 H295Q probably damaging Het
Cyp2j7 T C 4: 96,217,419 T285A probably benign Het
Dip2a G A 10: 76,318,091 T135M probably damaging Het
Fgf10 A G 13: 118,789,159 E158G probably damaging Het
Ftcd G T 10: 76,581,569 A281S probably benign Het
Gm16368 T G 12: 88,084,040 I115S probably damaging Het
Gpat4 A T 8: 23,179,470 M333K possibly damaging Het
Gpcpd1 A G 2: 132,534,753 L541P probably damaging Het
Grk5 T C 19: 61,083,225 Y408H probably damaging Het
Hcrtr2 A G 9: 76,246,345 probably null Het
Hsd17b13 T A 5: 103,968,767 N127I probably damaging Het
Hspa4 T G 11: 53,284,156 D158A probably benign Het
Ice2 G A 9: 69,415,575 A451T possibly damaging Het
Inpp5e A T 2: 26,408,157 I144K possibly damaging Het
Lrrc49 T C 9: 60,587,777 I652V possibly damaging Het
Man1a A T 10: 53,919,172 W571R probably damaging Het
Mecom A G 3: 29,993,658 S32P probably damaging Het
Mrpl40 A G 16: 18,872,474 I162T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T C 15: 12,257,630 W265R probably damaging Het
Mup21 C T 4: 62,149,426 V79I probably benign Het
Myh11 G A 16: 14,269,103 probably benign Het
Myom3 T A 4: 135,779,400 F495I probably benign Het
Ncoa7 A T 10: 30,698,126 probably benign Het
Nisch T C 14: 31,173,637 Y45C probably damaging Het
Nkain2 T A 10: 32,890,439 probably benign Het
Olfr356 A T 2: 36,937,763 I215F possibly damaging Het
Olfr728 A G 14: 50,140,172 S156P probably damaging Het
Pdcl A C 2: 37,355,696 H98Q probably damaging Het
Pink1 A G 4: 138,315,702 V427A probably damaging Het
Plce1 T C 19: 38,780,623 S2242P probably damaging Het
Plrg1 C A 3: 83,069,068 probably benign Het
Plxnc1 A G 10: 94,866,941 F586S possibly damaging Het
Pnpla7 G A 2: 25,040,973 V867M possibly damaging Het
Ppfia3 T A 7: 45,352,207 D427V possibly damaging Het
Ppp6r3 A T 19: 3,471,971 probably benign Het
Pros1 A T 16: 62,903,518 S210C probably damaging Het
Ptk2b A G 14: 66,158,392 S839P probably benign Het
Ptpre T C 7: 135,678,317 V570A possibly damaging Het
Rbm48 C T 5: 3,595,259 A142T probably damaging Het
Safb2 T C 17: 56,576,909 probably null Het
Scnn1a A G 6: 125,338,838 E384G probably benign Het
Sec23ip A G 7: 128,752,851 Y277C probably benign Het
Slc25a29 G A 12: 108,827,711 T42M probably damaging Het
Slc6a4 A T 11: 77,015,164 T264S probably benign Het
Srgap3 A G 6: 112,775,566 M319T probably damaging Het
Strn4 T A 7: 16,838,282 I640N probably damaging Het
Tacc2 A G 7: 130,623,745 D739G probably benign Het
Tigd4 T A 3: 84,593,935 L53* probably null Het
Tlr6 T A 5: 64,955,420 D48V probably damaging Het
Tmem125 T C 4: 118,541,904 D110G probably damaging Het
Tmem198 A G 1: 75,484,923 D341G probably damaging Het
Tnfaip3 A G 10: 19,004,934 F462L possibly damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ush2a T A 1: 188,678,289 I2378N possibly damaging Het
Usp47 A G 7: 112,054,920 T108A probably damaging Het
Vmn1r236 T A 17: 21,286,638 I6K probably benign Het
Vmn2r65 A T 7: 84,946,297 V393D probably damaging Het
Other mutations in Kirrel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel APN 3 87089875 missense probably benign 0.22
IGL01865:Kirrel APN 3 87086424 missense probably damaging 1.00
IGL01875:Kirrel APN 3 87095730 missense probably damaging 1.00
IGL02337:Kirrel APN 3 87089212 missense possibly damaging 0.64
IGL02724:Kirrel APN 3 87090473 nonsense probably null
IGL02825:Kirrel APN 3 87089288 splice site probably benign
IGL02826:Kirrel APN 3 87088485 missense probably damaging 1.00
IGL03102:Kirrel APN 3 87083500 missense probably damaging 0.98
D4043:Kirrel UTSW 3 87083203 missense probably benign 0.02
R0360:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0364:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0421:Kirrel UTSW 3 87083607 missense probably damaging 0.99
R0503:Kirrel UTSW 3 87097802 missense probably benign 0.20
R1112:Kirrel UTSW 3 87089151 missense probably null 0.46
R1116:Kirrel UTSW 3 87089151 missense probably null 0.46
R1144:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1190:Kirrel UTSW 3 87089151 missense probably null 0.46
R1226:Kirrel UTSW 3 87089151 missense probably null 0.46
R1501:Kirrel UTSW 3 87090472 missense probably benign 0.02
R1538:Kirrel UTSW 3 87089151 missense probably null 0.46
R1546:Kirrel UTSW 3 87089151 missense probably null 0.46
R1628:Kirrel UTSW 3 87089151 missense probably null 0.46
R1630:Kirrel UTSW 3 87089151 missense probably null 0.46
R1631:Kirrel UTSW 3 87089151 missense probably null 0.46
R1664:Kirrel UTSW 3 87089151 missense probably null 0.46
R1671:Kirrel UTSW 3 87089151 missense probably null 0.46
R1695:Kirrel UTSW 3 87089151 missense probably null 0.46
R1769:Kirrel UTSW 3 87089151 missense probably null 0.46
R1807:Kirrel UTSW 3 87089151 missense probably null 0.46
R1808:Kirrel UTSW 3 87089151 missense probably null 0.46
R1840:Kirrel UTSW 3 87089151 missense probably null 0.46
R1995:Kirrel UTSW 3 87095786 missense possibly damaging 0.88
R2014:Kirrel UTSW 3 87089151 missense probably null 0.46
R2086:Kirrel UTSW 3 87089151 missense probably null 0.46
R2108:Kirrel UTSW 3 87089151 missense probably null 0.46
R2354:Kirrel UTSW 3 87088485 missense probably damaging 0.98
R2407:Kirrel UTSW 3 87084843 missense probably benign 0.03
R2904:Kirrel UTSW 3 87089151 missense probably null 0.46
R2905:Kirrel UTSW 3 87089151 missense probably null 0.46
R2958:Kirrel UTSW 3 87089151 missense probably null 0.46
R2959:Kirrel UTSW 3 87089151 missense probably null 0.46
R2960:Kirrel UTSW 3 87089151 missense probably null 0.46
R2961:Kirrel UTSW 3 87089151 missense probably null 0.46
R3026:Kirrel UTSW 3 87089151 missense probably null 0.46
R3028:Kirrel UTSW 3 87089151 missense probably null 0.46
R3034:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R3149:Kirrel UTSW 3 87089151 missense probably null 0.46
R3195:Kirrel UTSW 3 87089151 missense probably null 0.46
R3196:Kirrel UTSW 3 87089151 missense probably null 0.46
R3499:Kirrel UTSW 3 87089151 missense probably null 0.46
R3699:Kirrel UTSW 3 87089151 missense probably null 0.46
R3720:Kirrel UTSW 3 87089151 missense probably null 0.46
R3721:Kirrel UTSW 3 87089151 missense probably null 0.46
R3788:Kirrel UTSW 3 87089151 missense probably null 0.46
R3793:Kirrel UTSW 3 87089151 missense probably null 0.46
R3876:Kirrel UTSW 3 87089151 missense probably null 0.46
R3877:Kirrel UTSW 3 87089151 missense probably null 0.46
R3901:Kirrel UTSW 3 87089151 missense probably null 0.46
R3910:Kirrel UTSW 3 87089151 missense probably null 0.46
R3911:Kirrel UTSW 3 87089151 missense probably null 0.46
R3912:Kirrel UTSW 3 87089151 missense probably null 0.46
R3913:Kirrel UTSW 3 87089151 missense probably null 0.46
R3930:Kirrel UTSW 3 87089151 missense probably null 0.46
R3931:Kirrel UTSW 3 87089151 missense probably null 0.46
R4022:Kirrel UTSW 3 87089151 missense probably null 0.46
R4067:Kirrel UTSW 3 87088467 nonsense probably null
R4077:Kirrel UTSW 3 87085080 critical splice donor site probably null
R4198:Kirrel UTSW 3 87089151 missense probably null 0.46
R4328:Kirrel UTSW 3 87084774 intron probably benign
R4355:Kirrel UTSW 3 87089151 missense probably null 0.46
R4363:Kirrel UTSW 3 87090485 nonsense probably null
R4378:Kirrel UTSW 3 87089151 missense probably null 0.46
R4386:Kirrel UTSW 3 87089151 missense probably null 0.46
R4460:Kirrel UTSW 3 87089151 missense probably null 0.46
R4468:Kirrel UTSW 3 87089151 missense probably null 0.46
R4469:Kirrel UTSW 3 87089151 missense probably null 0.46
R4650:Kirrel UTSW 3 87089151 missense probably null 0.46
R4652:Kirrel UTSW 3 87089151 missense probably null 0.46
R4734:Kirrel UTSW 3 87089151 missense probably null 0.46
R4748:Kirrel UTSW 3 87089151 missense probably null 0.46
R4749:Kirrel UTSW 3 87089151 missense probably null 0.46
R5304:Kirrel UTSW 3 87089595 missense probably benign 0.02
R5534:Kirrel UTSW 3 87090518 missense probably damaging 1.00
R5604:Kirrel UTSW 3 87089155 missense possibly damaging 0.69
R7199:Kirrel UTSW 3 87083388 missense probably benign 0.02
R7221:Kirrel UTSW 3 87086397 nonsense probably null
R7284:Kirrel UTSW 3 87083387 missense probably benign 0.02
R7332:Kirrel UTSW 3 87088398 missense probably benign 0.14
R7369:Kirrel UTSW 3 87141084 missense probably benign 0.20
R7371:Kirrel UTSW 3 87088422 missense probably benign 0.44
R7508:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R7566:Kirrel UTSW 3 87088484 missense probably damaging 1.00
R7567:Kirrel UTSW 3 87095681 missense probably damaging 0.99
R7621:Kirrel UTSW 3 87088221 missense possibly damaging 0.70
R8030:Kirrel UTSW 3 87097775 missense probably damaging 1.00
Z1177:Kirrel UTSW 3 87083875 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACCCTGAGTTCTATGCAAGTC -3'
(R):5'- AGCTGATGATTCTCAGGCAC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'
Posted On2014-06-30