Incidental Mutation 'R1876:Hcrtr2'
ID211238
Institutional Source Beutler Lab
Gene Symbol Hcrtr2
Ensembl Gene ENSMUSG00000032360
Gene Namehypocretin (orexin) receptor 2
SynonymsmOXR2, OX2r, mOX2aR, mOX2bR
MMRRC Submission 039898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1876 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76225880-76323856 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 76246345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063140] [ENSMUST00000184757]
Predicted Effect probably null
Transcript: ENSMUST00000063140
SMART Domains Protein: ENSMUSP00000058230
Gene: ENSMUSG00000032360

DomainStartEndE-ValueType
Pfam:7tm_1 71 364 2.2e-59 PFAM
Pfam:Orexin_rec2 386 443 1.2e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184757
SMART Domains Protein: ENSMUSP00000139377
Gene: ENSMUSG00000032360

DomainStartEndE-ValueType
Pfam:7tm_1 71 364 1.2e-59 PFAM
Pfam:Orexin_rec2 383 443 2.2e-47 PFAM
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein binds the hypothalamic neuropeptides orexin A and orexin B. A related gene (HCRTR1) encodes a G-protein coupled receptor that selectively binds orexin A. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice bearing targeted mutations in this gene exhibit fragmentation of sleep/wake states with similarity to narcolepsy and rare or very rare episodes of cataplexy. In addition, mice homozygous for a funtionally null allele display enhanced depression-likebehavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,877,549 C961F probably damaging Het
Abca16 A C 7: 120,433,385 D209A probably damaging Het
Adamts14 T C 10: 61,200,372 I1047V probably benign Het
Ak1 A G 2: 32,630,270 K27E probably damaging Het
Akap9 T A 5: 3,961,809 D837E probably benign Het
Arfgef3 T C 10: 18,597,356 Y1653C probably damaging Het
Atad2 T G 15: 58,106,868 I446L probably benign Het
Atp8b3 T G 10: 80,530,078 T313P possibly damaging Het
Btg4 T C 9: 51,117,189 L72S probably damaging Het
Canx A G 11: 50,304,359 I294T probably damaging Het
Casp1 G A 9: 5,303,663 E250K probably benign Het
Chchd10 T A 10: 75,936,332 S46T probably benign Het
Col12a1 G T 9: 79,678,281 Y1271* probably null Het
Col3a1 G A 1: 45,342,235 probably null Het
Ctc1 A T 11: 69,031,564 T872S probably benign Het
Cx3cl1 T C 8: 94,780,420 F351S probably damaging Het
Cyb5r4 T A 9: 87,055,814 H295Q probably damaging Het
Cyp2j7 T C 4: 96,217,419 T285A probably benign Het
Dip2a G A 10: 76,318,091 T135M probably damaging Het
Fgf10 A G 13: 118,789,159 E158G probably damaging Het
Ftcd G T 10: 76,581,569 A281S probably benign Het
Gm16368 T G 12: 88,084,040 I115S probably damaging Het
Gpat4 A T 8: 23,179,470 M333K possibly damaging Het
Gpcpd1 A G 2: 132,534,753 L541P probably damaging Het
Grk5 T C 19: 61,083,225 Y408H probably damaging Het
Hsd17b13 T A 5: 103,968,767 N127I probably damaging Het
Hspa4 T G 11: 53,284,156 D158A probably benign Het
Ice2 G A 9: 69,415,575 A451T possibly damaging Het
Inpp5e A T 2: 26,408,157 I144K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc49 T C 9: 60,587,777 I652V possibly damaging Het
Man1a A T 10: 53,919,172 W571R probably damaging Het
Mecom A G 3: 29,993,658 S32P probably damaging Het
Mrpl40 A G 16: 18,872,474 I162T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T C 15: 12,257,630 W265R probably damaging Het
Mup21 C T 4: 62,149,426 V79I probably benign Het
Myh11 G A 16: 14,269,103 probably benign Het
Myom3 T A 4: 135,779,400 F495I probably benign Het
Ncoa7 A T 10: 30,698,126 probably benign Het
Nisch T C 14: 31,173,637 Y45C probably damaging Het
Nkain2 T A 10: 32,890,439 probably benign Het
Olfr356 A T 2: 36,937,763 I215F possibly damaging Het
Olfr728 A G 14: 50,140,172 S156P probably damaging Het
Pdcl A C 2: 37,355,696 H98Q probably damaging Het
Pink1 A G 4: 138,315,702 V427A probably damaging Het
Plce1 T C 19: 38,780,623 S2242P probably damaging Het
Plrg1 C A 3: 83,069,068 probably benign Het
Plxnc1 A G 10: 94,866,941 F586S possibly damaging Het
Pnpla7 G A 2: 25,040,973 V867M possibly damaging Het
Ppfia3 T A 7: 45,352,207 D427V possibly damaging Het
Ppp6r3 A T 19: 3,471,971 probably benign Het
Pros1 A T 16: 62,903,518 S210C probably damaging Het
Ptk2b A G 14: 66,158,392 S839P probably benign Het
Ptpre T C 7: 135,678,317 V570A possibly damaging Het
Rbm48 C T 5: 3,595,259 A142T probably damaging Het
Safb2 T C 17: 56,576,909 probably null Het
Scnn1a A G 6: 125,338,838 E384G probably benign Het
Sec23ip A G 7: 128,752,851 Y277C probably benign Het
Slc25a29 G A 12: 108,827,711 T42M probably damaging Het
Slc6a4 A T 11: 77,015,164 T264S probably benign Het
Srgap3 A G 6: 112,775,566 M319T probably damaging Het
Strn4 T A 7: 16,838,282 I640N probably damaging Het
Tacc2 A G 7: 130,623,745 D739G probably benign Het
Tigd4 T A 3: 84,593,935 L53* probably null Het
Tlr6 T A 5: 64,955,420 D48V probably damaging Het
Tmem125 T C 4: 118,541,904 D110G probably damaging Het
Tmem198 A G 1: 75,484,923 D341G probably damaging Het
Tnfaip3 A G 10: 19,004,934 F462L possibly damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ush2a T A 1: 188,678,289 I2378N possibly damaging Het
Usp47 A G 7: 112,054,920 T108A probably damaging Het
Vmn1r236 T A 17: 21,286,638 I6K probably benign Het
Vmn2r65 A T 7: 84,946,297 V393D probably damaging Het
Other mutations in Hcrtr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Hcrtr2 APN 9 76228155 missense possibly damaging 0.86
IGL00492:Hcrtr2 APN 9 76246441 missense probably damaging 1.00
IGL00782:Hcrtr2 APN 9 76230497 utr 3 prime probably benign
IGL03096:Hcrtr2 APN 9 76254626 missense probably benign 0.01
PIT4508001:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0268:Hcrtr2 UTSW 9 76228188 missense probably benign
R0389:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0499:Hcrtr2 UTSW 9 76254672 missense probably damaging 1.00
R0607:Hcrtr2 UTSW 9 76230684 missense probably benign 0.00
R1622:Hcrtr2 UTSW 9 76323440 missense probably benign 0.03
R1637:Hcrtr2 UTSW 9 76232999 missense probably benign
R1698:Hcrtr2 UTSW 9 76246453 missense probably damaging 1.00
R1856:Hcrtr2 UTSW 9 76259785 missense probably damaging 1.00
R3411:Hcrtr2 UTSW 9 76233008 missense probably benign 0.30
R4469:Hcrtr2 UTSW 9 76230556 missense probably benign 0.30
R4560:Hcrtr2 UTSW 9 76254688 missense probably damaging 1.00
R4797:Hcrtr2 UTSW 9 76254534 missense probably damaging 1.00
R5001:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R5027:Hcrtr2 UTSW 9 76323296 missense probably benign 0.31
R5611:Hcrtr2 UTSW 9 76323314 missense probably damaging 0.98
R5770:Hcrtr2 UTSW 9 76259666 missense probably damaging 0.98
R5826:Hcrtr2 UTSW 9 76323287 missense probably benign 0.32
R6023:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R6110:Hcrtr2 UTSW 9 76259782 missense probably damaging 1.00
R7084:Hcrtr2 UTSW 9 76230660 missense probably benign 0.21
R7103:Hcrtr2 UTSW 9 76254511 missense probably benign 0.00
R7173:Hcrtr2 UTSW 9 76259731 missense probably damaging 1.00
R7783:Hcrtr2 UTSW 9 76232914 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCAGAGTTTATCAGAAGTGTAGAC -3'
(R):5'- ACTGGTCCCATCACTTGAGAAAC -3'

Sequencing Primer
(F):5'- CTTAAGGCAGAATTTAAGTCATTTGC -3'
(R):5'- GACTCTCATCTCAGGTGAAG -3'
Posted On2014-06-30