Incidental Mutation 'R1876:Atp8b3'
ID 211249
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission 039898-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R1876 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 80365912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 313 (T313P)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect possibly damaging
Transcript: ENSMUST00000020383
AA Change: T313P

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: T313P

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
AA Change: T313P

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 77,025,396 (GRCm39) C961F probably damaging Het
Abca16 A C 7: 120,032,608 (GRCm39) D209A probably damaging Het
Adamts14 T C 10: 61,036,151 (GRCm39) I1047V probably benign Het
Ak1 A G 2: 32,520,282 (GRCm39) K27E probably damaging Het
Akap9 T A 5: 4,011,809 (GRCm39) D837E probably benign Het
Arfgef3 T C 10: 18,473,104 (GRCm39) Y1653C probably damaging Het
Atad2 T G 15: 57,970,264 (GRCm39) I446L probably benign Het
Btg4 T C 9: 51,028,489 (GRCm39) L72S probably damaging Het
Canx A G 11: 50,195,186 (GRCm39) I294T probably damaging Het
Casp1 G A 9: 5,303,663 (GRCm39) E250K probably benign Het
Chchd10 T A 10: 75,772,166 (GRCm39) S46T probably benign Het
Col12a1 G T 9: 79,585,563 (GRCm39) Y1271* probably null Het
Col3a1 G A 1: 45,381,395 (GRCm39) probably null Het
Ctc1 A T 11: 68,922,390 (GRCm39) T872S probably benign Het
Cx3cl1 T C 8: 95,507,048 (GRCm39) F351S probably damaging Het
Cyb5r4 T A 9: 86,937,867 (GRCm39) H295Q probably damaging Het
Cyp2j7 T C 4: 96,105,656 (GRCm39) T285A probably benign Het
Dip2a G A 10: 76,153,925 (GRCm39) T135M probably damaging Het
Eif1ad18 T G 12: 88,050,810 (GRCm39) I115S probably damaging Het
Fgf10 A G 13: 118,925,695 (GRCm39) E158G probably damaging Het
Ftcd G T 10: 76,417,403 (GRCm39) A281S probably benign Het
Gpat4 A T 8: 23,669,486 (GRCm39) M333K possibly damaging Het
Gpcpd1 A G 2: 132,376,673 (GRCm39) L541P probably damaging Het
Grk5 T C 19: 61,071,663 (GRCm39) Y408H probably damaging Het
Hcrtr2 A G 9: 76,153,627 (GRCm39) probably null Het
Hsd17b13 T A 5: 104,116,633 (GRCm39) N127I probably damaging Het
Hspa4 T G 11: 53,174,983 (GRCm39) D158A probably benign Het
Ice2 G A 9: 69,322,857 (GRCm39) A451T possibly damaging Het
Inpp5e A T 2: 26,298,169 (GRCm39) I144K possibly damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lrrc49 T C 9: 60,495,060 (GRCm39) I652V possibly damaging Het
Man1a A T 10: 53,795,268 (GRCm39) W571R probably damaging Het
Mecom A G 3: 30,047,807 (GRCm39) S32P probably damaging Het
Mrpl40 A G 16: 18,691,224 (GRCm39) I162T probably benign Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtmr12 T C 15: 12,257,716 (GRCm39) W265R probably damaging Het
Mup21 C T 4: 62,067,663 (GRCm39) V79I probably benign Het
Myh11 G A 16: 14,086,967 (GRCm39) probably benign Het
Myom3 T A 4: 135,506,711 (GRCm39) F495I probably benign Het
Ncoa7 A T 10: 30,574,122 (GRCm39) probably benign Het
Nisch T C 14: 30,895,594 (GRCm39) Y45C probably damaging Het
Nkain2 T A 10: 32,766,435 (GRCm39) probably benign Het
Or1ak2 A T 2: 36,827,775 (GRCm39) I215F possibly damaging Het
Or4k1 A G 14: 50,377,629 (GRCm39) S156P probably damaging Het
Pdcl A C 2: 37,245,708 (GRCm39) H98Q probably damaging Het
Pink1 A G 4: 138,043,013 (GRCm39) V427A probably damaging Het
Plce1 T C 19: 38,769,067 (GRCm39) S2242P probably damaging Het
Plrg1 C A 3: 82,976,375 (GRCm39) probably benign Het
Plxnc1 A G 10: 94,702,803 (GRCm39) F586S possibly damaging Het
Pnpla7 G A 2: 24,930,985 (GRCm39) V867M possibly damaging Het
Ppfia3 T A 7: 45,001,631 (GRCm39) D427V possibly damaging Het
Ppp6r3 A T 19: 3,521,971 (GRCm39) probably benign Het
Pros1 A T 16: 62,723,881 (GRCm39) S210C probably damaging Het
Ptk2b A G 14: 66,395,841 (GRCm39) S839P probably benign Het
Ptpre T C 7: 135,280,046 (GRCm39) V570A possibly damaging Het
Rbm48 C T 5: 3,645,259 (GRCm39) A142T probably damaging Het
Safb2 T C 17: 56,883,909 (GRCm39) probably null Het
Scnn1a A G 6: 125,315,801 (GRCm39) E384G probably benign Het
Sec23ip A G 7: 128,354,575 (GRCm39) Y277C probably benign Het
Slc25a29 G A 12: 108,793,637 (GRCm39) T42M probably damaging Het
Slc6a4 A T 11: 76,905,990 (GRCm39) T264S probably benign Het
Srgap3 A G 6: 112,752,527 (GRCm39) M319T probably damaging Het
Strn4 T A 7: 16,572,207 (GRCm39) I640N probably damaging Het
Tacc2 A G 7: 130,225,475 (GRCm39) D739G probably benign Het
Tigd4 T A 3: 84,501,242 (GRCm39) L53* probably null Het
Tlr6 T A 5: 65,112,763 (GRCm39) D48V probably damaging Het
Tmem125 T C 4: 118,399,101 (GRCm39) D110G probably damaging Het
Tmem198 A G 1: 75,461,567 (GRCm39) D341G probably damaging Het
Tnfaip3 A G 10: 18,880,682 (GRCm39) F462L possibly damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 122,761,669 (GRCm39) probably benign Het
Ush2a T A 1: 188,410,486 (GRCm39) I2378N possibly damaging Het
Usp47 A G 7: 111,654,127 (GRCm39) T108A probably damaging Het
Vmn1r236 T A 17: 21,506,900 (GRCm39) I6K probably benign Het
Vmn2r65 A T 7: 84,595,505 (GRCm39) V393D probably damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGAACTCCGCACTGCAAG -3'
(R):5'- TTAAAGACAGTGAGCCCCAGAG -3'

Sequencing Primer
(F):5'- TGCAAGCAGCCGAGCAC -3'
(R):5'- AGAGCTGGACTGGGGTC -3'
Posted On 2014-06-30