Mutagenetix > Incidental Mutation

Incidental Mutation 'R1876:Atp8b3'

211249

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

039898-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R1876 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 80530078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 313 (T313P)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020383
AA Change: T313P

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: T313P

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220326
AA Change: T313P

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 95.1%
20x: 92.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	C	A	5: 76,877,549	C961F	probably damaging	Het
Abca16	A	C	7: 120,433,385	D209A	probably damaging	Het
Adamts14	T	C	10: 61,200,372	I1047V	probably benign	Het
Ak1	A	G	2: 32,630,270	K27E	probably damaging	Het
Akap9	T	A	5: 3,961,809	D837E	probably benign	Het
Arfgef3	T	C	10: 18,597,356	Y1653C	probably damaging	Het
Atad2	T	G	15: 58,106,868	I446L	probably benign	Het
Btg4	T	C	9: 51,117,189	L72S	probably damaging	Het
Canx	A	G	11: 50,304,359	I294T	probably damaging	Het
Casp1	G	A	9: 5,303,663	E250K	probably benign	Het
Chchd10	T	A	10: 75,936,332	S46T	probably benign	Het
Col12a1	G	T	9: 79,678,281	Y1271*	probably null	Het
Col3a1	G	A	1: 45,342,235		probably null	Het
Ctc1	A	T	11: 69,031,564	T872S	probably benign	Het
Cx3cl1	T	C	8: 94,780,420	F351S	probably damaging	Het
Cyb5r4	T	A	9: 87,055,814	H295Q	probably damaging	Het
Cyp2j7	T	C	4: 96,217,419	T285A	probably benign	Het
Dip2a	G	A	10: 76,318,091	T135M	probably damaging	Het
Fgf10	A	G	13: 118,789,159	E158G	probably damaging	Het
Ftcd	G	T	10: 76,581,569	A281S	probably benign	Het
Gm16368	T	G	12: 88,084,040	I115S	probably damaging	Het
Gpat4	A	T	8: 23,179,470	M333K	possibly damaging	Het
Gpcpd1	A	G	2: 132,534,753	L541P	probably damaging	Het
Grk5	T	C	19: 61,083,225	Y408H	probably damaging	Het
Hcrtr2	A	G	9: 76,246,345		probably null	Het
Hsd17b13	T	A	5: 103,968,767	N127I	probably damaging	Het
Hspa4	T	G	11: 53,284,156	D158A	probably benign	Het
Ice2	G	A	9: 69,415,575	A451T	possibly damaging	Het
Inpp5e	A	T	2: 26,408,157	I144K	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc49	T	C	9: 60,587,777	I652V	possibly damaging	Het
Man1a	A	T	10: 53,919,172	W571R	probably damaging	Het
Mecom	A	G	3: 29,993,658	S32P	probably damaging	Het
Mrpl40	A	G	16: 18,872,474	I162T	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mtmr12	T	C	15: 12,257,630	W265R	probably damaging	Het
Mup21	C	T	4: 62,149,426	V79I	probably benign	Het
Myh11	G	A	16: 14,269,103		probably benign	Het
Myom3	T	A	4: 135,779,400	F495I	probably benign	Het
Ncoa7	A	T	10: 30,698,126		probably benign	Het
Nisch	T	C	14: 31,173,637	Y45C	probably damaging	Het
Nkain2	T	A	10: 32,890,439		probably benign	Het
Olfr356	A	T	2: 36,937,763	I215F	possibly damaging	Het
Olfr728	A	G	14: 50,140,172	S156P	probably damaging	Het
Pdcl	A	C	2: 37,355,696	H98Q	probably damaging	Het
Pink1	A	G	4: 138,315,702	V427A	probably damaging	Het
Plce1	T	C	19: 38,780,623	S2242P	probably damaging	Het
Plrg1	C	A	3: 83,069,068		probably benign	Het
Plxnc1	A	G	10: 94,866,941	F586S	possibly damaging	Het
Pnpla7	G	A	2: 25,040,973	V867M	possibly damaging	Het
Ppfia3	T	A	7: 45,352,207	D427V	possibly damaging	Het
Ppp6r3	A	T	19: 3,471,971		probably benign	Het
Pros1	A	T	16: 62,903,518	S210C	probably damaging	Het
Ptk2b	A	G	14: 66,158,392	S839P	probably benign	Het
Ptpre	T	C	7: 135,678,317	V570A	possibly damaging	Het
Rbm48	C	T	5: 3,595,259	A142T	probably damaging	Het
Safb2	T	C	17: 56,576,909		probably null	Het
Scnn1a	A	G	6: 125,338,838	E384G	probably benign	Het
Sec23ip	A	G	7: 128,752,851	Y277C	probably benign	Het
Slc25a29	G	A	12: 108,827,711	T42M	probably damaging	Het
Slc6a4	A	T	11: 77,015,164	T264S	probably benign	Het
Srgap3	A	G	6: 112,775,566	M319T	probably damaging	Het
Strn4	T	A	7: 16,838,282	I640N	probably damaging	Het
Tacc2	A	G	7: 130,623,745	D739G	probably benign	Het
Tigd4	T	A	3: 84,593,935	L53*	probably null	Het
Tlr6	T	A	5: 64,955,420	D48V	probably damaging	Het
Tmem125	T	C	4: 118,541,904	D110G	probably damaging	Het
Tmem198	A	G	1: 75,484,923	D341G	probably damaging	Het
Tnfaip3	A	G	10: 19,004,934	F462L	possibly damaging	Het
Tnrc6a	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	7: 123,162,446		probably benign	Het
Ush2a	T	A	1: 188,678,289	I2378N	possibly damaging	Het
Usp47	A	G	7: 112,054,920	T108A	probably damaging	Het
Vmn1r236	T	A	17: 21,286,638	I6K	probably benign	Het
Vmn2r65	A	T	7: 84,946,297	V393D	probably damaging	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATGAACTCCGCACTGCAAG -3'
(R):5'- TTAAAGACAGTGAGCCCCAGAG -3'

Sequencing Primer
(F):5'- TGCAAGCAGCCGAGCAC -3'
(R):5'- AGAGCTGGACTGGGGTC -3'

Posted On

2014-06-30