Incidental Mutation 'R0122:Tmprss3'
ID21128
Institutional Source Beutler Lab
Gene Symbol Tmprss3
Ensembl Gene ENSMUSG00000024034
Gene Nametransmembrane protease, serine 3
Synonyms
MMRRC Submission 038407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0122 (G1)
Quality Score202
Status Validated
Chromosome17
Chromosomal Location31179272-31198975 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 31193902 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024833] [ENSMUST00000114549]
Predicted Effect probably benign
Transcript: ENSMUST00000024833
SMART Domains Protein: ENSMUSP00000024833
Gene: ENSMUSG00000024034

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
LDLa 72 109 1.76e-5 SMART
SR 108 205 3.99e-4 SMART
Tryp_SPc 216 443 5.22e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114549
SMART Domains Protein: ENSMUSP00000110196
Gene: ENSMUSG00000024034

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
LDLa 94 131 1.76e-5 SMART
SR 130 227 3.99e-4 SMART
Tryp_SPc 238 465 5.22e-96 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a serine protease domain, a transmembrane domain, an LDL receptor-like domain, and a scavenger receptor cysteine-rich domain. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified by its association with both congenital and childhood onset autosomal recessive deafness. This gene is expressed in fetal cochlea and many other tissues, and is thought to be involved in the development and maintenance of the inner ear or the contents of the perilymph and endolymph. This gene was also identified as a tumor-associated gene that is overexpressed in ovarian tumors. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit early onset deafness and disrupted vestibular function associated with hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Adam12 T A 7: 134,012,348 I60F probably benign Het
Adamts10 A G 17: 33,528,480 probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Adamts7 A G 9: 90,179,421 E360G probably damaging Het
Atn1 A T 6: 124,743,234 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Baz2b G T 2: 59,913,619 probably null Het
Bloc1s6 G C 2: 122,746,043 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qa T A 4: 136,897,831 T3S probably benign Het
Cacna1e A T 1: 154,443,901 F1351Y probably damaging Het
Car9 C T 4: 43,512,206 A356V probably benign Het
Ccdc116 T A 16: 17,142,734 D73V probably damaging Het
Ces2g T C 8: 104,968,300 Y518H probably damaging Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cmc1 A T 9: 118,065,320 C29S probably damaging Het
Coil T A 11: 88,985,007 probably benign Het
Col3a1 C T 1: 45,340,897 probably benign Het
Cox15 A G 19: 43,748,790 I135T possibly damaging Het
Cyld T C 8: 88,742,292 S564P probably damaging Het
Dnah5 T A 15: 28,378,363 N2948K probably damaging Het
Dnah7a G A 1: 53,397,142 R4014W probably damaging Het
Dnmt3b T C 2: 153,676,698 Y594H probably damaging Het
Dntt A G 19: 41,053,038 K387R possibly damaging Het
Efcab7 G A 4: 99,892,363 probably benign Het
Flvcr1 G T 1: 191,021,226 P250T possibly damaging Het
Gga2 C A 7: 121,991,574 V504L probably damaging Het
Gm12239 T A 11: 56,015,912 noncoding transcript Het
Gm13089 A T 4: 143,698,404 D156E probably benign Het
Gm6327 T C 16: 12,761,026 noncoding transcript Het
Krt26 G T 11: 99,333,719 Y324* probably null Het
Lamb2 A T 9: 108,486,514 H939L probably benign Het
Lipo3 C T 19: 33,622,686 probably benign Het
Mmp1b G A 9: 7,386,689 T145M probably damaging Het
Mrps27 G T 13: 99,365,228 V76L probably benign Het
Mup6 T A 4: 60,003,995 Y29* probably null Het
Nlrc3 T C 16: 3,958,958 K756E probably damaging Het
Nnt T C 13: 119,368,597 H527R probably damaging Het
Nudt8 T C 19: 4,001,306 V59A probably benign Het
Ofcc1 A T 13: 40,280,556 probably null Het
Olfr447 T C 6: 42,911,955 V144A probably benign Het
Olfr638 T C 7: 104,003,358 W28R probably damaging Het
Olfr959 A T 9: 39,572,724 D178E probably damaging Het
Pdgfd T C 9: 6,293,851 S142P probably damaging Het
Pias4 G T 10: 81,157,087 Q22K probably damaging Het
Pin1 T C 9: 20,662,304 I95T probably benign Het
Prickle2 G A 6: 92,411,345 Q359* probably null Het
Qrich2 G T 11: 116,446,813 Q1950K possibly damaging Het
Rab10 C A 12: 3,309,357 G21V probably damaging Het
Rbm27 T A 18: 42,313,968 probably benign Het
Samd4 C A 14: 47,016,560 S160R probably benign Het
Scube3 A C 17: 28,166,528 probably benign Het
Serpinf2 A G 11: 75,436,546 L185P probably damaging Het
Slc16a12 A G 19: 34,674,864 I294T probably benign Het
Slc45a3 T A 1: 131,977,740 M167K probably damaging Het
Sspo T A 6: 48,473,976 L2673Q possibly damaging Het
Supt3 A G 17: 45,003,141 D139G probably damaging Het
Tas1r3 T C 4: 155,860,833 M644V probably benign Het
Tgfbi A G 13: 56,627,968 T276A probably damaging Het
Tmem177 T C 1: 119,910,578 I124V probably benign Het
Tmprss11f G T 5: 86,533,625 probably benign Het
Twf1 A G 15: 94,586,549 probably benign Het
Uba52 T A 8: 70,509,301 Q166L probably damaging Het
Ubr3 G T 2: 69,979,412 G1242V probably damaging Het
Unc13d C T 11: 116,065,482 S835N probably benign Het
Ush2a A G 1: 188,948,455 K4877E possibly damaging Het
Vmn2r98 A G 17: 19,066,400 I387V probably benign Het
Vps11 A T 9: 44,354,512 I490N probably damaging Het
Vstm4 T A 14: 32,863,811 probably null Het
Zfp110 C A 7: 12,848,597 H391N possibly damaging Het
Zfp212 C T 6: 47,931,023 P312L possibly damaging Het
Zfp329 A T 7: 12,810,987 H203Q probably damaging Het
Zscan12 G A 13: 21,368,969 G321E probably damaging Het
Other mutations in Tmprss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tmprss3 APN 17 31195008 missense probably damaging 0.97
IGL01836:Tmprss3 APN 17 31191044 missense probably benign
IGL02525:Tmprss3 APN 17 31194891 splice site probably benign
IGL02672:Tmprss3 APN 17 31191007 missense probably damaging 1.00
IGL02900:Tmprss3 APN 17 31184579 missense probably damaging 1.00
R0617:Tmprss3 UTSW 17 31193912 missense probably damaging 1.00
R4001:Tmprss3 UTSW 17 31186559 missense probably damaging 1.00
R5587:Tmprss3 UTSW 17 31193992 missense probably benign 0.00
R6077:Tmprss3 UTSW 17 31189167 missense possibly damaging 0.94
R6271:Tmprss3 UTSW 17 31186562 missense probably damaging 1.00
R6329:Tmprss3 UTSW 17 31183859 nonsense probably null
R6918:Tmprss3 UTSW 17 31188357 missense probably benign 0.19
R8279:Tmprss3 UTSW 17 31197735 missense probably benign 0.20
R8372:Tmprss3 UTSW 17 31184697 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGCACAGGCAATCTTGGCATAG -3'
(R):5'- TTGATAGGCAAGTTCAAGGCCACAC -3'

Sequencing Primer
(F):5'- AGTCATCGGAGCACATGGTC -3'
(R):5'- TTCAAGGCCACACGGCAG -3'
Posted On2013-04-11