Incidental Mutation 'R1878:Or4c105'
ID 211282
Institutional Source Beutler Lab
Gene Symbol Or4c105
Ensembl Gene ENSMUSG00000064084
Gene Name olfactory receptor family 4 subfamily C member 105
Synonyms Olfr1202, GA_x6K02T2Q125-50290367-50291296, MOR232-7
MMRRC Submission 039899-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R1878 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 88643145-88648446 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88647805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 97 (T97A)
Ref Sequence ENSEMBL: ENSMUSP00000150743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072057] [ENSMUST00000214703] [ENSMUST00000217059]
AlphaFold Q8VF98
Predicted Effect probably benign
Transcript: ENSMUST00000072057
AA Change: T97A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071935
Gene: ENSMUSG00000064084
AA Change: T97A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6.8e-47 PFAM
Pfam:7tm_1 39 285 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214703
AA Change: T97A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000217059
AA Change: T97A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,825,564 (GRCm39) probably null Het
Abcb9 A G 5: 124,228,199 (GRCm39) V14A probably benign Het
Adcy4 T C 14: 56,007,362 (GRCm39) D950G probably damaging Het
Ahctf1 T C 1: 179,603,074 (GRCm39) D828G possibly damaging Het
Ak2 T A 4: 128,895,960 (GRCm39) V79D probably damaging Het
Arhgap29 T C 3: 121,805,020 (GRCm39) Y870H probably damaging Het
Arid4a A G 12: 71,134,363 (GRCm39) K1222E probably damaging Het
Armc1 A T 3: 19,211,708 (GRCm39) D37E probably damaging Het
Cenpm A T 15: 82,118,616 (GRCm39) M166K probably benign Het
Cep97 G T 16: 55,725,589 (GRCm39) P766Q probably damaging Het
Col19a1 G T 1: 24,356,476 (GRCm39) D672E probably benign Het
Col6a2 T C 10: 76,450,622 (GRCm39) D103G probably benign Het
Ddi2 T C 4: 141,411,460 (GRCm39) E484G probably benign Het
Dph1 T C 11: 75,075,053 (GRCm39) D100G probably damaging Het
Dsp A T 13: 38,348,831 (GRCm39) I100F possibly damaging Het
Fam222b T C 11: 78,034,042 (GRCm39) probably null Het
Folh1 A T 7: 86,420,950 (GRCm39) H126Q probably benign Het
Gapvd1 A T 2: 34,615,212 (GRCm39) D428E probably benign Het
Gfus A G 15: 75,797,218 (GRCm39) S306P probably benign Het
Gm11564 A T 11: 99,706,266 (GRCm39) C55S unknown Het
Gne T C 4: 44,040,434 (GRCm39) I577V probably damaging Het
Gpr4 A G 7: 18,957,049 (GRCm39) T324A probably damaging Het
Hhipl1 A T 12: 108,286,319 (GRCm39) N542I possibly damaging Het
Ice2 T C 9: 69,335,858 (GRCm39) probably null Het
Irgm1 C T 11: 48,756,897 (GRCm39) V305I probably benign Het
Itgal C A 7: 126,909,843 (GRCm39) Q73K probably benign Het
Jcad C A 18: 4,673,857 (GRCm39) H540N possibly damaging Het
Jkamp T A 12: 72,140,878 (GRCm39) V141D possibly damaging Het
Lrrc9 T C 12: 72,522,938 (GRCm39) probably null Het
Mcc T C 18: 44,601,467 (GRCm39) R621G possibly damaging Het
Myd88 T A 9: 119,167,686 (GRCm39) Q140L probably benign Het
Mylk3 A T 8: 86,082,028 (GRCm39) N323K possibly damaging Het
Myrip C T 9: 120,253,721 (GRCm39) R265W probably damaging Het
N4bp1 A T 8: 87,588,169 (GRCm39) S256R probably damaging Het
Nhsl1 T G 10: 18,400,027 (GRCm39) S418A probably damaging Het
Nlrp9b A G 7: 19,762,489 (GRCm39) T269A probably benign Het
Nmt1 A G 11: 102,943,077 (GRCm39) N144S probably benign Het
Npvf G A 6: 50,631,303 (GRCm39) T24I probably benign Het
Obscn T G 11: 58,886,379 (GRCm39) Y2347S probably damaging Het
Or10d5 T A 9: 39,862,053 (GRCm39) T5S probably benign Het
Or14j1 T C 17: 38,146,253 (GRCm39) V121A probably benign Het
Or1j16 G T 2: 36,530,201 (GRCm39) R50M possibly damaging Het
Or2aj5 G T 16: 19,424,501 (GRCm39) Q306K probably benign Het
Or2n1c T C 17: 38,519,265 (GRCm39) I43T probably benign Het
Or51v8 A C 7: 103,319,389 (GRCm39) M283R probably damaging Het
Or7a42 T A 10: 78,791,639 (GRCm39) M200K possibly damaging Het
Osgin2 A T 4: 16,005,493 (GRCm39) V131D probably damaging Het
Pcdhac2 A T 18: 37,278,215 (GRCm39) K398N possibly damaging Het
Pcnp A T 16: 55,838,850 (GRCm39) M143K probably damaging Het
Ppp3ca A G 3: 136,503,639 (GRCm39) I71V probably benign Het
Ppp4c G T 7: 126,386,779 (GRCm39) R103S probably damaging Het
Prl2c2 T A 13: 13,179,911 (GRCm39) M1L probably damaging Het
Recql5 A T 11: 115,785,927 (GRCm39) D615E probably benign Het
Robo3 T C 9: 37,333,461 (GRCm39) E728G probably damaging Het
Rps27l T A 9: 66,854,911 (GRCm39) probably null Het
Scube3 T A 17: 28,371,387 (GRCm39) V34E probably benign Het
Sez6l A G 5: 112,623,089 (GRCm39) I154T probably damaging Het
Sgsm1 G A 5: 113,411,381 (GRCm39) L782F probably damaging Het
Slc35c1 A G 2: 92,289,398 (GRCm39) V36A probably benign Het
Snapc4 A G 2: 26,266,165 (GRCm39) probably null Het
Sohlh2 C A 3: 55,115,064 (GRCm39) R350S probably damaging Het
Spag1 G A 15: 36,181,916 (GRCm39) E25K probably damaging Het
Sspo G A 6: 48,436,300 (GRCm39) A1217T possibly damaging Het
Stil T C 4: 114,898,423 (GRCm39) S1018P probably damaging Het
Strn T C 17: 78,984,755 (GRCm39) E117G possibly damaging Het
Syt17 A T 7: 118,033,468 (GRCm39) M180K probably benign Het
Trem1 T C 17: 48,548,516 (GRCm39) S18P possibly damaging Het
Umad1 T A 6: 8,427,181 (GRCm39) F145I probably damaging Het
Unc80 A C 1: 66,548,561 (GRCm39) H611P probably damaging Het
Zfp1004 T A 2: 150,034,989 (GRCm39) C437S probably damaging Het
Zfp709 A G 8: 72,643,891 (GRCm39) E440G probably damaging Het
Zfp764 C A 7: 127,004,214 (GRCm39) A306S probably benign Het
Zfp949 T A 9: 88,451,356 (GRCm39) S309T probably damaging Het
Zswim4 T C 8: 84,939,405 (GRCm39) N826D possibly damaging Het
Other mutations in Or4c105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03221:Or4c105 APN 2 88,647,781 (GRCm39) missense possibly damaging 0.54
R0105:Or4c105 UTSW 2 88,648,253 (GRCm39) missense probably damaging 1.00
R0699:Or4c105 UTSW 2 88,647,568 (GRCm39) missense probably damaging 1.00
R0709:Or4c105 UTSW 2 88,648,226 (GRCm39) missense probably benign 0.42
R1177:Or4c105 UTSW 2 88,647,704 (GRCm39) missense probably benign 0.06
R1436:Or4c105 UTSW 2 88,648,336 (GRCm39) missense possibly damaging 0.48
R1827:Or4c105 UTSW 2 88,648,402 (GRCm39) missense probably benign 0.04
R1828:Or4c105 UTSW 2 88,648,402 (GRCm39) missense probably benign 0.04
R1872:Or4c105 UTSW 2 88,648,280 (GRCm39) missense probably benign 0.02
R4903:Or4c105 UTSW 2 88,648,342 (GRCm39) missense probably benign 0.14
R5035:Or4c105 UTSW 2 88,648,443 (GRCm39) missense probably benign 0.01
R6279:Or4c105 UTSW 2 88,647,719 (GRCm39) missense probably damaging 1.00
R7402:Or4c105 UTSW 2 88,647,687 (GRCm39) missense probably damaging 1.00
R7809:Or4c105 UTSW 2 88,647,902 (GRCm39) missense probably damaging 0.96
R8172:Or4c105 UTSW 2 88,647,986 (GRCm39) missense probably damaging 1.00
R8193:Or4c105 UTSW 2 88,647,803 (GRCm39) missense probably damaging 1.00
R8673:Or4c105 UTSW 2 88,647,590 (GRCm39) missense probably benign
R8730:Or4c105 UTSW 2 88,648,043 (GRCm39) missense possibly damaging 0.64
R9459:Or4c105 UTSW 2 88,647,967 (GRCm39) missense probably benign 0.12
R9772:Or4c105 UTSW 2 88,647,958 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGGCTCACACAGAATCTG -3'
(R):5'- TGTATACCTCCATGAAGAAAGCC -3'

Sequencing Primer
(F):5'- GGCTCACACAGAATCTGCACTTG -3'
(R):5'- TGAAGAAAGCCTCCAACCCATG -3'
Posted On 2014-06-30