Incidental Mutation 'R1878:Folh1'
ID 211304
Institutional Source Beutler Lab
Gene Symbol Folh1
Ensembl Gene ENSMUSG00000001773
Gene Name folate hydrolase 1
Synonyms GCP2, mopsm, glutamate carboxypeptidase II, prostate-specific membrane antigen
MMRRC Submission 039899-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1878 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 86368185-86425151 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86420950 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 126 (H126Q)
Ref Sequence ENSEMBL: ENSMUSP00000102892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001824] [ENSMUST00000107271]
AlphaFold O35409
Predicted Effect probably benign
Transcript: ENSMUST00000001824
AA Change: H126Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001824
Gene: ENSMUSG00000001773
AA Change: H126Q

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 171 264 2.5e-16 PFAM
Pfam:Peptidase_M28 359 561 1.2e-18 PFAM
Pfam:TFR_dimer 629 749 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107271
AA Change: H126Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102892
Gene: ENSMUSG00000001773
AA Change: H126Q

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 167 265 7e-18 PFAM
Pfam:Peptidase_M28 339 475 2.1e-15 PFAM
Pfam:TFR_dimer 595 718 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in protection from peripheral neuropathy and ischemic brain injury. Homozygotes for a null allele show increased food intake, anxiety-like behavior, smaller sciatic nerve axons, and impaired angiogenesis. Homozygotes for a different null allele show less neuron degeneration and astrocyte damage after traumatic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,825,564 (GRCm39) probably null Het
Abcb9 A G 5: 124,228,199 (GRCm39) V14A probably benign Het
Adcy4 T C 14: 56,007,362 (GRCm39) D950G probably damaging Het
Ahctf1 T C 1: 179,603,074 (GRCm39) D828G possibly damaging Het
Ak2 T A 4: 128,895,960 (GRCm39) V79D probably damaging Het
Arhgap29 T C 3: 121,805,020 (GRCm39) Y870H probably damaging Het
Arid4a A G 12: 71,134,363 (GRCm39) K1222E probably damaging Het
Armc1 A T 3: 19,211,708 (GRCm39) D37E probably damaging Het
Cenpm A T 15: 82,118,616 (GRCm39) M166K probably benign Het
Cep97 G T 16: 55,725,589 (GRCm39) P766Q probably damaging Het
Col19a1 G T 1: 24,356,476 (GRCm39) D672E probably benign Het
Col6a2 T C 10: 76,450,622 (GRCm39) D103G probably benign Het
Ddi2 T C 4: 141,411,460 (GRCm39) E484G probably benign Het
Dph1 T C 11: 75,075,053 (GRCm39) D100G probably damaging Het
Dsp A T 13: 38,348,831 (GRCm39) I100F possibly damaging Het
Fam222b T C 11: 78,034,042 (GRCm39) probably null Het
Gapvd1 A T 2: 34,615,212 (GRCm39) D428E probably benign Het
Gfus A G 15: 75,797,218 (GRCm39) S306P probably benign Het
Gm11564 A T 11: 99,706,266 (GRCm39) C55S unknown Het
Gne T C 4: 44,040,434 (GRCm39) I577V probably damaging Het
Gpr4 A G 7: 18,957,049 (GRCm39) T324A probably damaging Het
Hhipl1 A T 12: 108,286,319 (GRCm39) N542I possibly damaging Het
Ice2 T C 9: 69,335,858 (GRCm39) probably null Het
Irgm1 C T 11: 48,756,897 (GRCm39) V305I probably benign Het
Itgal C A 7: 126,909,843 (GRCm39) Q73K probably benign Het
Jcad C A 18: 4,673,857 (GRCm39) H540N possibly damaging Het
Jkamp T A 12: 72,140,878 (GRCm39) V141D possibly damaging Het
Lrrc9 T C 12: 72,522,938 (GRCm39) probably null Het
Mcc T C 18: 44,601,467 (GRCm39) R621G possibly damaging Het
Myd88 T A 9: 119,167,686 (GRCm39) Q140L probably benign Het
Mylk3 A T 8: 86,082,028 (GRCm39) N323K possibly damaging Het
Myrip C T 9: 120,253,721 (GRCm39) R265W probably damaging Het
N4bp1 A T 8: 87,588,169 (GRCm39) S256R probably damaging Het
Nhsl1 T G 10: 18,400,027 (GRCm39) S418A probably damaging Het
Nlrp9b A G 7: 19,762,489 (GRCm39) T269A probably benign Het
Nmt1 A G 11: 102,943,077 (GRCm39) N144S probably benign Het
Npvf G A 6: 50,631,303 (GRCm39) T24I probably benign Het
Obscn T G 11: 58,886,379 (GRCm39) Y2347S probably damaging Het
Or10d5 T A 9: 39,862,053 (GRCm39) T5S probably benign Het
Or14j1 T C 17: 38,146,253 (GRCm39) V121A probably benign Het
Or1j16 G T 2: 36,530,201 (GRCm39) R50M possibly damaging Het
Or2aj5 G T 16: 19,424,501 (GRCm39) Q306K probably benign Het
Or2n1c T C 17: 38,519,265 (GRCm39) I43T probably benign Het
Or4c105 A G 2: 88,647,805 (GRCm39) T97A probably benign Het
Or51v8 A C 7: 103,319,389 (GRCm39) M283R probably damaging Het
Or7a42 T A 10: 78,791,639 (GRCm39) M200K possibly damaging Het
Osgin2 A T 4: 16,005,493 (GRCm39) V131D probably damaging Het
Pcdhac2 A T 18: 37,278,215 (GRCm39) K398N possibly damaging Het
Pcnp A T 16: 55,838,850 (GRCm39) M143K probably damaging Het
Ppp3ca A G 3: 136,503,639 (GRCm39) I71V probably benign Het
Ppp4c G T 7: 126,386,779 (GRCm39) R103S probably damaging Het
Prl2c2 T A 13: 13,179,911 (GRCm39) M1L probably damaging Het
Recql5 A T 11: 115,785,927 (GRCm39) D615E probably benign Het
Robo3 T C 9: 37,333,461 (GRCm39) E728G probably damaging Het
Rps27l T A 9: 66,854,911 (GRCm39) probably null Het
Scube3 T A 17: 28,371,387 (GRCm39) V34E probably benign Het
Sez6l A G 5: 112,623,089 (GRCm39) I154T probably damaging Het
Sgsm1 G A 5: 113,411,381 (GRCm39) L782F probably damaging Het
Slc35c1 A G 2: 92,289,398 (GRCm39) V36A probably benign Het
Snapc4 A G 2: 26,266,165 (GRCm39) probably null Het
Sohlh2 C A 3: 55,115,064 (GRCm39) R350S probably damaging Het
Spag1 G A 15: 36,181,916 (GRCm39) E25K probably damaging Het
Sspo G A 6: 48,436,300 (GRCm39) A1217T possibly damaging Het
Stil T C 4: 114,898,423 (GRCm39) S1018P probably damaging Het
Strn T C 17: 78,984,755 (GRCm39) E117G possibly damaging Het
Syt17 A T 7: 118,033,468 (GRCm39) M180K probably benign Het
Trem1 T C 17: 48,548,516 (GRCm39) S18P possibly damaging Het
Umad1 T A 6: 8,427,181 (GRCm39) F145I probably damaging Het
Unc80 A C 1: 66,548,561 (GRCm39) H611P probably damaging Het
Zfp1004 T A 2: 150,034,989 (GRCm39) C437S probably damaging Het
Zfp709 A G 8: 72,643,891 (GRCm39) E440G probably damaging Het
Zfp764 C A 7: 127,004,214 (GRCm39) A306S probably benign Het
Zfp949 T A 9: 88,451,356 (GRCm39) S309T probably damaging Het
Zswim4 T C 8: 84,939,405 (GRCm39) N826D possibly damaging Het
Other mutations in Folh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Folh1 APN 7 86,383,351 (GRCm39) missense probably damaging 1.00
IGL00531:Folh1 APN 7 86,368,977 (GRCm39) missense possibly damaging 0.82
IGL00772:Folh1 APN 7 86,380,992 (GRCm39) missense probably damaging 1.00
IGL01339:Folh1 APN 7 86,375,306 (GRCm39) missense probably damaging 1.00
IGL01373:Folh1 APN 7 86,395,350 (GRCm39) missense probably benign 0.39
IGL01645:Folh1 APN 7 86,391,435 (GRCm39) missense probably damaging 1.00
IGL01736:Folh1 APN 7 86,391,444 (GRCm39) missense possibly damaging 0.96
IGL02104:Folh1 APN 7 86,393,638 (GRCm39) missense possibly damaging 0.93
IGL02124:Folh1 APN 7 86,374,626 (GRCm39) missense probably damaging 0.99
IGL02338:Folh1 APN 7 86,385,723 (GRCm39) splice site probably benign
IGL02440:Folh1 APN 7 86,383,312 (GRCm39) missense probably benign 0.09
IGL02689:Folh1 APN 7 86,412,253 (GRCm39) splice site probably null
IGL02976:Folh1 APN 7 86,412,126 (GRCm39) missense probably benign
IGL03022:Folh1 APN 7 86,395,379 (GRCm39) missense possibly damaging 0.76
R0090:Folh1 UTSW 7 86,375,076 (GRCm39) splice site probably benign
R0285:Folh1 UTSW 7 86,391,373 (GRCm39) splice site probably benign
R0482:Folh1 UTSW 7 86,395,309 (GRCm39) splice site probably benign
R0492:Folh1 UTSW 7 86,395,400 (GRCm39) missense probably damaging 1.00
R1079:Folh1 UTSW 7 86,421,089 (GRCm39) missense probably damaging 1.00
R1148:Folh1 UTSW 7 86,410,938 (GRCm39) missense probably damaging 1.00
R1148:Folh1 UTSW 7 86,410,938 (GRCm39) missense probably damaging 1.00
R1493:Folh1 UTSW 7 86,410,938 (GRCm39) missense probably damaging 1.00
R1778:Folh1 UTSW 7 86,410,907 (GRCm39) critical splice donor site probably null
R1865:Folh1 UTSW 7 86,375,114 (GRCm39) missense possibly damaging 0.65
R1906:Folh1 UTSW 7 86,391,374 (GRCm39) splice site probably null
R1912:Folh1 UTSW 7 86,412,175 (GRCm39) missense possibly damaging 0.95
R2263:Folh1 UTSW 7 86,368,973 (GRCm39) missense probably benign
R3001:Folh1 UTSW 7 86,372,519 (GRCm39) missense probably damaging 1.00
R3002:Folh1 UTSW 7 86,372,519 (GRCm39) missense probably damaging 1.00
R3883:Folh1 UTSW 7 86,424,864 (GRCm39) missense possibly damaging 0.48
R4061:Folh1 UTSW 7 86,406,170 (GRCm39) missense possibly damaging 0.49
R4277:Folh1 UTSW 7 86,412,123 (GRCm39) critical splice donor site probably null
R4507:Folh1 UTSW 7 86,406,216 (GRCm39) missense probably benign
R4627:Folh1 UTSW 7 86,422,460 (GRCm39) missense probably benign 0.00
R4652:Folh1 UTSW 7 86,393,633 (GRCm39) nonsense probably null
R4653:Folh1 UTSW 7 86,393,633 (GRCm39) nonsense probably null
R4745:Folh1 UTSW 7 86,372,482 (GRCm39) critical splice donor site probably null
R5571:Folh1 UTSW 7 86,383,328 (GRCm39) missense probably damaging 1.00
R6000:Folh1 UTSW 7 86,375,142 (GRCm39) missense probably benign 0.01
R6307:Folh1 UTSW 7 86,372,517 (GRCm39) missense probably damaging 1.00
R6474:Folh1 UTSW 7 86,424,964 (GRCm39) missense probably damaging 0.99
R7112:Folh1 UTSW 7 86,424,845 (GRCm39) critical splice donor site probably null
R7131:Folh1 UTSW 7 86,375,320 (GRCm39) missense probably damaging 1.00
R7449:Folh1 UTSW 7 86,380,956 (GRCm39) missense probably benign 0.00
R7494:Folh1 UTSW 7 86,368,907 (GRCm39) missense probably damaging 1.00
R7539:Folh1 UTSW 7 86,375,117 (GRCm39) missense probably benign 0.35
R7764:Folh1 UTSW 7 86,412,126 (GRCm39) missense probably benign
R7803:Folh1 UTSW 7 86,375,306 (GRCm39) missense probably damaging 1.00
R8105:Folh1 UTSW 7 86,395,354 (GRCm39) missense probably damaging 1.00
R8208:Folh1 UTSW 7 86,375,125 (GRCm39) missense probably damaging 0.98
R8347:Folh1 UTSW 7 86,378,326 (GRCm39) nonsense probably null
R9130:Folh1 UTSW 7 86,368,913 (GRCm39) missense probably benign 0.12
R9749:Folh1 UTSW 7 86,368,908 (GRCm39) missense probably damaging 1.00
R9764:Folh1 UTSW 7 86,406,158 (GRCm39) missense probably benign 0.03
RF007:Folh1 UTSW 7 86,424,895 (GRCm39) missense probably benign
Z1088:Folh1 UTSW 7 86,375,162 (GRCm39) missense probably benign 0.00
Z1177:Folh1 UTSW 7 86,411,030 (GRCm39) missense probably benign 0.00
Z1177:Folh1 UTSW 7 86,393,655 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCCAAATCACACTAAGTTCA -3'
(R):5'- CCTATTGAAAACGCAGACAGACT -3'

Sequencing Primer
(F):5'- GTTCAAACACTCCAAGAAATAAACTG -3'
(R):5'- TATTGAAAACGCAGACAGACTAAAAG -3'
Posted On 2014-06-30