Incidental Mutation 'R1878:Syt17'
ID 211306
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Name synaptotagmin XVII
Synonyms Bk
MMRRC Submission 039899-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1878 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 117979940-118047445 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118033468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 180 (M180K)
Ref Sequence ENSEMBL: ENSMUSP00000144987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000207034]
AlphaFold Q920M7
Predicted Effect probably benign
Transcript: ENSMUST00000081574
AA Change: M176K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420
AA Change: M176K

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203465
AA Change: M175K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000203485
AA Change: M180K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420
AA Change: M180K

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203796
AA Change: M119K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420
AA Change: M119K

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,825,564 (GRCm39) probably null Het
Abcb9 A G 5: 124,228,199 (GRCm39) V14A probably benign Het
Adcy4 T C 14: 56,007,362 (GRCm39) D950G probably damaging Het
Ahctf1 T C 1: 179,603,074 (GRCm39) D828G possibly damaging Het
Ak2 T A 4: 128,895,960 (GRCm39) V79D probably damaging Het
Arhgap29 T C 3: 121,805,020 (GRCm39) Y870H probably damaging Het
Arid4a A G 12: 71,134,363 (GRCm39) K1222E probably damaging Het
Armc1 A T 3: 19,211,708 (GRCm39) D37E probably damaging Het
Cenpm A T 15: 82,118,616 (GRCm39) M166K probably benign Het
Cep97 G T 16: 55,725,589 (GRCm39) P766Q probably damaging Het
Col19a1 G T 1: 24,356,476 (GRCm39) D672E probably benign Het
Col6a2 T C 10: 76,450,622 (GRCm39) D103G probably benign Het
Ddi2 T C 4: 141,411,460 (GRCm39) E484G probably benign Het
Dph1 T C 11: 75,075,053 (GRCm39) D100G probably damaging Het
Dsp A T 13: 38,348,831 (GRCm39) I100F possibly damaging Het
Fam222b T C 11: 78,034,042 (GRCm39) probably null Het
Folh1 A T 7: 86,420,950 (GRCm39) H126Q probably benign Het
Gapvd1 A T 2: 34,615,212 (GRCm39) D428E probably benign Het
Gfus A G 15: 75,797,218 (GRCm39) S306P probably benign Het
Gm11564 A T 11: 99,706,266 (GRCm39) C55S unknown Het
Gne T C 4: 44,040,434 (GRCm39) I577V probably damaging Het
Gpr4 A G 7: 18,957,049 (GRCm39) T324A probably damaging Het
Hhipl1 A T 12: 108,286,319 (GRCm39) N542I possibly damaging Het
Ice2 T C 9: 69,335,858 (GRCm39) probably null Het
Irgm1 C T 11: 48,756,897 (GRCm39) V305I probably benign Het
Itgal C A 7: 126,909,843 (GRCm39) Q73K probably benign Het
Jcad C A 18: 4,673,857 (GRCm39) H540N possibly damaging Het
Jkamp T A 12: 72,140,878 (GRCm39) V141D possibly damaging Het
Lrrc9 T C 12: 72,522,938 (GRCm39) probably null Het
Mcc T C 18: 44,601,467 (GRCm39) R621G possibly damaging Het
Myd88 T A 9: 119,167,686 (GRCm39) Q140L probably benign Het
Mylk3 A T 8: 86,082,028 (GRCm39) N323K possibly damaging Het
Myrip C T 9: 120,253,721 (GRCm39) R265W probably damaging Het
N4bp1 A T 8: 87,588,169 (GRCm39) S256R probably damaging Het
Nhsl1 T G 10: 18,400,027 (GRCm39) S418A probably damaging Het
Nlrp9b A G 7: 19,762,489 (GRCm39) T269A probably benign Het
Nmt1 A G 11: 102,943,077 (GRCm39) N144S probably benign Het
Npvf G A 6: 50,631,303 (GRCm39) T24I probably benign Het
Obscn T G 11: 58,886,379 (GRCm39) Y2347S probably damaging Het
Or10d5 T A 9: 39,862,053 (GRCm39) T5S probably benign Het
Or14j1 T C 17: 38,146,253 (GRCm39) V121A probably benign Het
Or1j16 G T 2: 36,530,201 (GRCm39) R50M possibly damaging Het
Or2aj5 G T 16: 19,424,501 (GRCm39) Q306K probably benign Het
Or2n1c T C 17: 38,519,265 (GRCm39) I43T probably benign Het
Or4c105 A G 2: 88,647,805 (GRCm39) T97A probably benign Het
Or51v8 A C 7: 103,319,389 (GRCm39) M283R probably damaging Het
Or7a42 T A 10: 78,791,639 (GRCm39) M200K possibly damaging Het
Osgin2 A T 4: 16,005,493 (GRCm39) V131D probably damaging Het
Pcdhac2 A T 18: 37,278,215 (GRCm39) K398N possibly damaging Het
Pcnp A T 16: 55,838,850 (GRCm39) M143K probably damaging Het
Ppp3ca A G 3: 136,503,639 (GRCm39) I71V probably benign Het
Ppp4c G T 7: 126,386,779 (GRCm39) R103S probably damaging Het
Prl2c2 T A 13: 13,179,911 (GRCm39) M1L probably damaging Het
Recql5 A T 11: 115,785,927 (GRCm39) D615E probably benign Het
Robo3 T C 9: 37,333,461 (GRCm39) E728G probably damaging Het
Rps27l T A 9: 66,854,911 (GRCm39) probably null Het
Scube3 T A 17: 28,371,387 (GRCm39) V34E probably benign Het
Sez6l A G 5: 112,623,089 (GRCm39) I154T probably damaging Het
Sgsm1 G A 5: 113,411,381 (GRCm39) L782F probably damaging Het
Slc35c1 A G 2: 92,289,398 (GRCm39) V36A probably benign Het
Snapc4 A G 2: 26,266,165 (GRCm39) probably null Het
Sohlh2 C A 3: 55,115,064 (GRCm39) R350S probably damaging Het
Spag1 G A 15: 36,181,916 (GRCm39) E25K probably damaging Het
Sspo G A 6: 48,436,300 (GRCm39) A1217T possibly damaging Het
Stil T C 4: 114,898,423 (GRCm39) S1018P probably damaging Het
Strn T C 17: 78,984,755 (GRCm39) E117G possibly damaging Het
Trem1 T C 17: 48,548,516 (GRCm39) S18P possibly damaging Het
Umad1 T A 6: 8,427,181 (GRCm39) F145I probably damaging Het
Unc80 A C 1: 66,548,561 (GRCm39) H611P probably damaging Het
Zfp1004 T A 2: 150,034,989 (GRCm39) C437S probably damaging Het
Zfp709 A G 8: 72,643,891 (GRCm39) E440G probably damaging Het
Zfp764 C A 7: 127,004,214 (GRCm39) A306S probably benign Het
Zfp949 T A 9: 88,451,356 (GRCm39) S309T probably damaging Het
Zswim4 T C 8: 84,939,405 (GRCm39) N826D possibly damaging Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118,033,513 (GRCm39) missense probably damaging 0.98
IGL01135:Syt17 APN 7 117,981,270 (GRCm39) missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118,007,389 (GRCm39) missense probably damaging 0.99
IGL01610:Syt17 APN 7 118,033,216 (GRCm39) missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118,009,176 (GRCm39) missense probably damaging 0.99
IGL02125:Syt17 APN 7 118,009,197 (GRCm39) missense probably benign 0.01
IGL02819:Syt17 APN 7 118,009,143 (GRCm39) splice site probably benign
H8562:Syt17 UTSW 7 118,007,292 (GRCm39) missense probably benign 0.01
R0127:Syt17 UTSW 7 118,009,164 (GRCm39) missense probably damaging 0.98
R0328:Syt17 UTSW 7 117,981,216 (GRCm39) missense probably benign 0.28
R1789:Syt17 UTSW 7 118,036,061 (GRCm39) missense probably benign 0.00
R1872:Syt17 UTSW 7 118,007,341 (GRCm39) missense probably benign 0.00
R1918:Syt17 UTSW 7 118,033,208 (GRCm39) missense possibly damaging 0.54
R2133:Syt17 UTSW 7 117,981,270 (GRCm39) missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118,033,180 (GRCm39) missense probably damaging 1.00
R4471:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4472:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4567:Syt17 UTSW 7 118,033,495 (GRCm39) missense probably benign 0.06
R5211:Syt17 UTSW 7 118,041,626 (GRCm39) missense probably benign 0.19
R5905:Syt17 UTSW 7 118,036,141 (GRCm39) missense probably benign 0.10
R6054:Syt17 UTSW 7 118,007,356 (GRCm39) missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118,033,513 (GRCm39) missense probably damaging 0.98
R6332:Syt17 UTSW 7 118,033,466 (GRCm39) missense probably benign 0.00
R7022:Syt17 UTSW 7 118,007,242 (GRCm39) missense probably benign 0.00
R7440:Syt17 UTSW 7 117,981,107 (GRCm39) missense probably damaging 1.00
R7610:Syt17 UTSW 7 118,033,682 (GRCm39) splice site probably null
R7845:Syt17 UTSW 7 118,009,194 (GRCm39) missense possibly damaging 0.79
R8294:Syt17 UTSW 7 118,009,228 (GRCm39) missense probably damaging 0.99
R8296:Syt17 UTSW 7 118,036,069 (GRCm39) missense probably damaging 0.97
R8429:Syt17 UTSW 7 118,033,564 (GRCm39) missense probably benign
R8949:Syt17 UTSW 7 118,033,054 (GRCm39) critical splice donor site probably null
R9278:Syt17 UTSW 7 118,033,480 (GRCm39) missense probably damaging 1.00
R9622:Syt17 UTSW 7 118,036,191 (GRCm39) missense probably benign
R9629:Syt17 UTSW 7 118,007,379 (GRCm39) missense probably damaging 0.96
Z1177:Syt17 UTSW 7 118,033,446 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCAAACACAGGCTTCTGGG -3'
(R):5'- TCAAACCCGTTGAGTTCGGC -3'

Sequencing Primer
(F):5'- CACAGGCTTCTGGGTCTTGC -3'
(R):5'- GCGTTCTCAGTGCCAAGAAG -3'
Posted On 2014-06-30