Incidental Mutation 'R1878:Lrrc9'
ID 211334
Institutional Source Beutler Lab
Gene Symbol Lrrc9
Ensembl Gene ENSMUSG00000021090
Gene Name leucine rich repeat containing 9
Synonyms 4921529O18Rik, 4930432K16Rik
MMRRC Submission 039899-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R1878 (G1)
Quality Score 128
Status Not validated
Chromosome 12
Chromosomal Location 72481391-72561269 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 72522938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000221360]
AlphaFold Q8CDN9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161195
Predicted Effect probably null
Transcript: ENSMUST00000161284
SMART Domains Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090

DomainStartEndE-ValueType
Pfam:LRR_4 77 118 2.8e-11 PFAM
LRR 119 140 8.49e1 SMART
LRR 141 164 2.27e1 SMART
LRR 165 187 2.09e2 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 706 727 1.41e2 SMART
LRR 728 749 6.78e1 SMART
LRR 750 773 7.17e1 SMART
LRRcap 793 811 2.26e2 SMART
LRR 943 966 2.67e-1 SMART
LRR 967 992 1.22e1 SMART
LRRcap 1031 1049 4.37e0 SMART
low complexity region 1109 1120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161957
Predicted Effect probably null
Transcript: ENSMUST00000162159
SMART Domains Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090

DomainStartEndE-ValueType
LRR 53 74 5.39e2 SMART
LRR 75 96 1.14e2 SMART
LRR 97 118 7.9e-4 SMART
LRR 119 140 2.75e-3 SMART
LRR 141 164 2.27e1 SMART
LRR 164 185 1.87e1 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 705 726 1.41e2 SMART
LRR 727 748 6.78e1 SMART
LRR 749 771 1.37e1 SMART
LRRcap 792 810 2.26e2 SMART
LRR 898 919 2.62e1 SMART
LRR 920 941 5.17e1 SMART
LRR 942 965 2.67e-1 SMART
LRR 966 991 1.22e1 SMART
LRR 1013 1032 4.42e2 SMART
LRRcap 1030 1048 4.37e0 SMART
low complexity region 1108 1119 N/A INTRINSIC
LRR 1128 1150 2.4e1 SMART
LRR 1191 1209 5.7e2 SMART
LRR 1215 1236 1.03e-2 SMART
LRR 1237 1260 8.48e0 SMART
LRR 1283 1304 2.67e-1 SMART
Blast:LRR 1308 1333 4e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196758
Predicted Effect probably benign
Transcript: ENSMUST00000221360
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,825,564 (GRCm39) probably null Het
Abcb9 A G 5: 124,228,199 (GRCm39) V14A probably benign Het
Adcy4 T C 14: 56,007,362 (GRCm39) D950G probably damaging Het
Ahctf1 T C 1: 179,603,074 (GRCm39) D828G possibly damaging Het
Ak2 T A 4: 128,895,960 (GRCm39) V79D probably damaging Het
Arhgap29 T C 3: 121,805,020 (GRCm39) Y870H probably damaging Het
Arid4a A G 12: 71,134,363 (GRCm39) K1222E probably damaging Het
Armc1 A T 3: 19,211,708 (GRCm39) D37E probably damaging Het
Cenpm A T 15: 82,118,616 (GRCm39) M166K probably benign Het
Cep97 G T 16: 55,725,589 (GRCm39) P766Q probably damaging Het
Col19a1 G T 1: 24,356,476 (GRCm39) D672E probably benign Het
Col6a2 T C 10: 76,450,622 (GRCm39) D103G probably benign Het
Ddi2 T C 4: 141,411,460 (GRCm39) E484G probably benign Het
Dph1 T C 11: 75,075,053 (GRCm39) D100G probably damaging Het
Dsp A T 13: 38,348,831 (GRCm39) I100F possibly damaging Het
Fam222b T C 11: 78,034,042 (GRCm39) probably null Het
Folh1 A T 7: 86,420,950 (GRCm39) H126Q probably benign Het
Gapvd1 A T 2: 34,615,212 (GRCm39) D428E probably benign Het
Gfus A G 15: 75,797,218 (GRCm39) S306P probably benign Het
Gm11564 A T 11: 99,706,266 (GRCm39) C55S unknown Het
Gne T C 4: 44,040,434 (GRCm39) I577V probably damaging Het
Gpr4 A G 7: 18,957,049 (GRCm39) T324A probably damaging Het
Hhipl1 A T 12: 108,286,319 (GRCm39) N542I possibly damaging Het
Ice2 T C 9: 69,335,858 (GRCm39) probably null Het
Irgm1 C T 11: 48,756,897 (GRCm39) V305I probably benign Het
Itgal C A 7: 126,909,843 (GRCm39) Q73K probably benign Het
Jcad C A 18: 4,673,857 (GRCm39) H540N possibly damaging Het
Jkamp T A 12: 72,140,878 (GRCm39) V141D possibly damaging Het
Mcc T C 18: 44,601,467 (GRCm39) R621G possibly damaging Het
Myd88 T A 9: 119,167,686 (GRCm39) Q140L probably benign Het
Mylk3 A T 8: 86,082,028 (GRCm39) N323K possibly damaging Het
Myrip C T 9: 120,253,721 (GRCm39) R265W probably damaging Het
N4bp1 A T 8: 87,588,169 (GRCm39) S256R probably damaging Het
Nhsl1 T G 10: 18,400,027 (GRCm39) S418A probably damaging Het
Nlrp9b A G 7: 19,762,489 (GRCm39) T269A probably benign Het
Nmt1 A G 11: 102,943,077 (GRCm39) N144S probably benign Het
Npvf G A 6: 50,631,303 (GRCm39) T24I probably benign Het
Obscn T G 11: 58,886,379 (GRCm39) Y2347S probably damaging Het
Or10d5 T A 9: 39,862,053 (GRCm39) T5S probably benign Het
Or14j1 T C 17: 38,146,253 (GRCm39) V121A probably benign Het
Or1j16 G T 2: 36,530,201 (GRCm39) R50M possibly damaging Het
Or2aj5 G T 16: 19,424,501 (GRCm39) Q306K probably benign Het
Or2n1c T C 17: 38,519,265 (GRCm39) I43T probably benign Het
Or4c105 A G 2: 88,647,805 (GRCm39) T97A probably benign Het
Or51v8 A C 7: 103,319,389 (GRCm39) M283R probably damaging Het
Or7a42 T A 10: 78,791,639 (GRCm39) M200K possibly damaging Het
Osgin2 A T 4: 16,005,493 (GRCm39) V131D probably damaging Het
Pcdhac2 A T 18: 37,278,215 (GRCm39) K398N possibly damaging Het
Pcnp A T 16: 55,838,850 (GRCm39) M143K probably damaging Het
Ppp3ca A G 3: 136,503,639 (GRCm39) I71V probably benign Het
Ppp4c G T 7: 126,386,779 (GRCm39) R103S probably damaging Het
Prl2c2 T A 13: 13,179,911 (GRCm39) M1L probably damaging Het
Recql5 A T 11: 115,785,927 (GRCm39) D615E probably benign Het
Robo3 T C 9: 37,333,461 (GRCm39) E728G probably damaging Het
Rps27l T A 9: 66,854,911 (GRCm39) probably null Het
Scube3 T A 17: 28,371,387 (GRCm39) V34E probably benign Het
Sez6l A G 5: 112,623,089 (GRCm39) I154T probably damaging Het
Sgsm1 G A 5: 113,411,381 (GRCm39) L782F probably damaging Het
Slc35c1 A G 2: 92,289,398 (GRCm39) V36A probably benign Het
Snapc4 A G 2: 26,266,165 (GRCm39) probably null Het
Sohlh2 C A 3: 55,115,064 (GRCm39) R350S probably damaging Het
Spag1 G A 15: 36,181,916 (GRCm39) E25K probably damaging Het
Sspo G A 6: 48,436,300 (GRCm39) A1217T possibly damaging Het
Stil T C 4: 114,898,423 (GRCm39) S1018P probably damaging Het
Strn T C 17: 78,984,755 (GRCm39) E117G possibly damaging Het
Syt17 A T 7: 118,033,468 (GRCm39) M180K probably benign Het
Trem1 T C 17: 48,548,516 (GRCm39) S18P possibly damaging Het
Umad1 T A 6: 8,427,181 (GRCm39) F145I probably damaging Het
Unc80 A C 1: 66,548,561 (GRCm39) H611P probably damaging Het
Zfp1004 T A 2: 150,034,989 (GRCm39) C437S probably damaging Het
Zfp709 A G 8: 72,643,891 (GRCm39) E440G probably damaging Het
Zfp764 C A 7: 127,004,214 (GRCm39) A306S probably benign Het
Zfp949 T A 9: 88,451,356 (GRCm39) S309T probably damaging Het
Zswim4 T C 8: 84,939,405 (GRCm39) N826D possibly damaging Het
Other mutations in Lrrc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Lrrc9 APN 12 72,533,017 (GRCm39) missense possibly damaging 0.63
IGL00843:Lrrc9 APN 12 72,510,191 (GRCm39) missense possibly damaging 0.78
IGL01923:Lrrc9 APN 12 72,557,186 (GRCm39) missense possibly damaging 0.93
IGL02027:Lrrc9 APN 12 72,517,108 (GRCm39) splice site probably benign
IGL02271:Lrrc9 APN 12 72,557,155 (GRCm39) missense probably benign 0.06
IGL02398:Lrrc9 APN 12 72,513,677 (GRCm39) missense probably benign
IGL02795:Lrrc9 APN 12 72,525,542 (GRCm39) missense probably damaging 1.00
IGL02931:Lrrc9 APN 12 72,500,923 (GRCm39) missense probably damaging 1.00
IGL03257:Lrrc9 APN 12 72,496,542 (GRCm39) missense probably benign
BB006:Lrrc9 UTSW 12 72,533,071 (GRCm39) missense possibly damaging 0.92
BB016:Lrrc9 UTSW 12 72,533,071 (GRCm39) missense possibly damaging 0.92
IGL02799:Lrrc9 UTSW 12 72,553,178 (GRCm39) missense probably damaging 1.00
R0172:Lrrc9 UTSW 12 72,510,260 (GRCm39) missense possibly damaging 0.50
R0315:Lrrc9 UTSW 12 72,502,802 (GRCm39) missense probably damaging 0.96
R0492:Lrrc9 UTSW 12 72,525,537 (GRCm39) missense possibly damaging 0.47
R0617:Lrrc9 UTSW 12 72,529,788 (GRCm39) missense probably damaging 1.00
R0639:Lrrc9 UTSW 12 72,533,062 (GRCm39) missense probably damaging 1.00
R0987:Lrrc9 UTSW 12 72,557,156 (GRCm39) missense probably benign 0.00
R1325:Lrrc9 UTSW 12 72,543,878 (GRCm39) missense probably damaging 0.99
R1465:Lrrc9 UTSW 12 72,547,533 (GRCm39) missense probably benign 0.05
R1465:Lrrc9 UTSW 12 72,547,533 (GRCm39) missense probably benign 0.05
R1479:Lrrc9 UTSW 12 72,507,599 (GRCm39) nonsense probably null
R1564:Lrrc9 UTSW 12 72,533,827 (GRCm39) missense probably damaging 1.00
R1626:Lrrc9 UTSW 12 72,542,435 (GRCm39) splice site probably null
R1632:Lrrc9 UTSW 12 72,506,794 (GRCm39) splice site probably null
R1715:Lrrc9 UTSW 12 72,524,073 (GRCm39) missense probably damaging 1.00
R1743:Lrrc9 UTSW 12 72,502,891 (GRCm39) missense probably damaging 1.00
R1779:Lrrc9 UTSW 12 72,502,772 (GRCm39) nonsense probably null
R1866:Lrrc9 UTSW 12 72,543,912 (GRCm39) missense probably damaging 0.97
R1990:Lrrc9 UTSW 12 72,544,635 (GRCm39) missense probably damaging 0.99
R2361:Lrrc9 UTSW 12 72,510,244 (GRCm39) missense possibly damaging 0.52
R3752:Lrrc9 UTSW 12 72,507,580 (GRCm39) nonsense probably null
R3833:Lrrc9 UTSW 12 72,529,765 (GRCm39) missense probably damaging 1.00
R4134:Lrrc9 UTSW 12 72,513,740 (GRCm39) missense probably benign 0.00
R4651:Lrrc9 UTSW 12 72,524,160 (GRCm39) missense probably damaging 1.00
R4652:Lrrc9 UTSW 12 72,524,160 (GRCm39) missense probably damaging 1.00
R4659:Lrrc9 UTSW 12 72,517,038 (GRCm39) missense probably damaging 1.00
R4831:Lrrc9 UTSW 12 72,546,453 (GRCm39) missense probably damaging 1.00
R4857:Lrrc9 UTSW 12 72,546,466 (GRCm39) missense possibly damaging 0.94
R5017:Lrrc9 UTSW 12 72,553,099 (GRCm39) missense possibly damaging 0.86
R5163:Lrrc9 UTSW 12 72,496,163 (GRCm39) missense probably damaging 1.00
R5279:Lrrc9 UTSW 12 72,542,368 (GRCm39) missense possibly damaging 0.80
R5434:Lrrc9 UTSW 12 72,500,862 (GRCm39) missense probably damaging 0.98
R5783:Lrrc9 UTSW 12 72,502,827 (GRCm39) missense possibly damaging 0.62
R6021:Lrrc9 UTSW 12 72,516,005 (GRCm39) missense probably damaging 0.97
R6214:Lrrc9 UTSW 12 72,506,627 (GRCm39) missense probably damaging 1.00
R6255:Lrrc9 UTSW 12 72,533,797 (GRCm39) missense probably benign 0.33
R6538:Lrrc9 UTSW 12 72,547,703 (GRCm39) missense probably benign 0.08
R6563:Lrrc9 UTSW 12 72,533,169 (GRCm39) splice site probably null
R6672:Lrrc9 UTSW 12 72,520,710 (GRCm39) missense possibly damaging 0.88
R6919:Lrrc9 UTSW 12 72,553,167 (GRCm39) missense probably benign 0.01
R6929:Lrrc9 UTSW 12 72,497,546 (GRCm39) missense probably benign 0.41
R7092:Lrrc9 UTSW 12 72,510,238 (GRCm39) missense possibly damaging 0.81
R7150:Lrrc9 UTSW 12 72,513,726 (GRCm39) missense probably benign 0.00
R7338:Lrrc9 UTSW 12 72,510,305 (GRCm39) splice site probably null
R7398:Lrrc9 UTSW 12 72,547,590 (GRCm39) missense probably damaging 0.98
R7477:Lrrc9 UTSW 12 72,550,301 (GRCm39) critical splice donor site probably null
R7501:Lrrc9 UTSW 12 72,496,490 (GRCm39) missense probably damaging 1.00
R7542:Lrrc9 UTSW 12 72,553,094 (GRCm39) missense probably damaging 0.96
R7816:Lrrc9 UTSW 12 72,542,466 (GRCm39) missense probably damaging 1.00
R7870:Lrrc9 UTSW 12 72,532,964 (GRCm39) missense probably damaging 0.99
R7929:Lrrc9 UTSW 12 72,533,071 (GRCm39) missense possibly damaging 0.92
R8042:Lrrc9 UTSW 12 72,507,680 (GRCm39) missense probably benign 0.02
R8108:Lrrc9 UTSW 12 72,500,833 (GRCm39) missense probably damaging 1.00
R8192:Lrrc9 UTSW 12 72,496,163 (GRCm39) missense probably damaging 1.00
R8244:Lrrc9 UTSW 12 72,546,384 (GRCm39) missense probably benign 0.22
R8333:Lrrc9 UTSW 12 72,528,317 (GRCm39) missense probably benign 0.38
R9288:Lrrc9 UTSW 12 72,522,858 (GRCm39) missense probably benign 0.01
R9324:Lrrc9 UTSW 12 72,496,171 (GRCm39) missense probably damaging 1.00
R9342:Lrrc9 UTSW 12 72,506,767 (GRCm39) missense probably damaging 1.00
R9557:Lrrc9 UTSW 12 72,532,981 (GRCm39) missense probably benign 0.01
R9624:Lrrc9 UTSW 12 72,497,586 (GRCm39) missense probably benign 0.19
R9677:Lrrc9 UTSW 12 72,497,539 (GRCm39) missense probably damaging 1.00
X0025:Lrrc9 UTSW 12 72,543,834 (GRCm39) missense probably damaging 1.00
Z1176:Lrrc9 UTSW 12 72,524,167 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTGGCTACTAACGCCTACAC -3'
(R):5'- GCCTTGTAAGCACACTCTCC -3'

Sequencing Primer
(F):5'- GCTACTAACGCCTACACCATGTC -3'
(R):5'- GTAAGGCCTTCTAACTGACACAGTG -3'
Posted On 2014-06-30