Incidental Mutation 'R1878:Trem1'
ID 211350
Institutional Source Beutler Lab
Gene Symbol Trem1
Ensembl Gene ENSMUSG00000042265
Gene Name triggering receptor expressed on myeloid cells 1
Synonyms
MMRRC Submission 039899-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1878 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 48232768-48246924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48241488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 18 (S18P)
Ref Sequence ENSEMBL: ENSMUSP00000108877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048782] [ENSMUST00000113251]
AlphaFold Q9JKE2
Predicted Effect probably benign
Transcript: ENSMUST00000048782
AA Change: S137P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038636
Gene: ENSMUSG00000042265
AA Change: S137P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 134 1.25e-4 SMART
low complexity region 159 170 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113251
AA Change: S18P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108877
Gene: ENSMUSG00000042265
AA Change: S18P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
transmembrane domain 83 105 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor belonging to the Ig superfamily that is expressed on myeloid cells. This protein amplifies neutrophil and monocyte-mediated inflammatory responses triggered by bacterial and fungal infections by stimulating release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit decreased susceptibility to DEN induced tumors and liver damage. Mice homozygous for a knock-out allele of Trem1 and Trem3 exhibit increased susceptibility to P. aeruginosa infection with reduced neutrophil transepithelial migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Trem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Trem1 APN 17 48237249 missense probably benign 0.14
IGL01729:Trem1 APN 17 48244575 missense possibly damaging 0.90
IGL01756:Trem1 APN 17 48237113 nonsense probably null
IGL02348:Trem1 APN 17 48232796 start codon destroyed probably null 1.00
IGL02720:Trem1 APN 17 48232841 missense probably benign 0.03
R0589:Trem1 UTSW 17 48237217 missense possibly damaging 0.93
R1807:Trem1 UTSW 17 48241635 nonsense probably null
R4648:Trem1 UTSW 17 48244562 missense probably benign 0.10
R5121:Trem1 UTSW 17 48232836 missense probably null 0.00
R5387:Trem1 UTSW 17 48241513 missense possibly damaging 0.92
R5623:Trem1 UTSW 17 48237055 missense probably damaging 1.00
R5953:Trem1 UTSW 17 48237192 missense probably benign 0.01
R6538:Trem1 UTSW 17 48237090 missense possibly damaging 0.86
R8898:Trem1 UTSW 17 48237346 missense probably damaging 1.00
R9099:Trem1 UTSW 17 48237243 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AAACTTGCTTCTTGGATGGCC -3'
(R):5'- GGTGTCCAAACCAAGAGCCAAG -3'

Sequencing Primer
(F):5'- GGATGGCCATGTTTATTTCCC -3'
(R):5'- AACATACCTGTCAGCATCTGTC -3'
Posted On 2014-06-30