Mutagenetix > Incidental Mutations

Incidental Mutation 'R1879:Clpb'

211388

Institutional Source

Beutler Lab

Gene Symbol

Clpb

Ensembl Gene

ENSMUSG00000001829

Gene Name

ClpB caseinolytic peptidase B

Synonyms

Skd3

MMRRC Submission

039900-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R1879 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101663633-101795506 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 101706483 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 181 (S181R)

Ref Sequence

ENSEMBL: ENSMUSP00000102611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000123870] [ENSMUST00000209579]

Predicted Effect

probably benign
Transcript: ENSMUST00000001884
AA Change: S181R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829
AA Change: S181R

Domain	Start	End	E-Value	Type
ANK	133	162	2.03e-1	SMART
ANK	166	195	1.96e-3	SMART
ANK	235	264	6.65e-6	SMART
low complexity region	294	306	N/A	INTRINSIC
AAA	343	497	6.36e-10	SMART
ClpB_D2-small	541	630	6.83e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106998
AA Change: S181R

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829
AA Change: S181R

Domain	Start	End	E-Value	Type
ANK	133	162	2.03e-1	SMART
ANK	166	195	1.96e-3	SMART
ANK	265	294	6.65e-6	SMART
low complexity region	324	336	N/A	INTRINSIC
AAA	373	527	6.36e-10	SMART
ClpB_D2-small	571	660	6.83e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123870

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147439

SMART Domains

Protein: ENSMUSP00000115609
Gene: ENSMUSG00000001829

Domain	Start	End	E-Value	Type
ANK	1	24	2.66e3	SMART
Blast:ANK	26	55	2e-11	BLAST
ANK	64	93	6.65e-6	SMART
Blast:ANK	97	120	2e-7	BLAST
low complexity region	123	135	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150355

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153473

SMART Domains

Protein: ENSMUSP00000119922
Gene: ENSMUSG00000001829

Domain	Start	End	E-Value	Type
ANK	1	24	2.66e3	SMART
Blast:ANK	26	55	8e-12	BLAST
ANK	64	93	6.65e-6	SMART
Blast:ANK	97	117	2e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000209579
AA Change: S181R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 97.3%
3x: 96.6%
10x: 94.9%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,476	D268G	possibly damaging	Het
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abce1	T	C	8: 79,687,456	N542S	probably benign	Het
Abcf1	T	A	17: 35,961,812	E260D	probably benign	Het
Ahcy	A	G	2: 155,064,152		probably null	Het
Akap13	C	T	7: 75,610,727	A1033V	probably benign	Het
Alkbh6	A	G	7: 30,311,895	N46S	probably damaging	Het
Ankrd34c	A	C	9: 89,730,073	L72V	probably damaging	Het
Arf4	T	A	14: 26,646,921	N25K	probably damaging	Het
Arhgef4	A	G	1: 34,722,440	D259G	unknown	Het
Cavin1	C	A	11: 100,970,210	G86V	probably damaging	Het
Ces1d	G	A	8: 93,189,498	T167I	probably benign	Het
Cfb	T	C	17: 34,860,560	I754V	probably benign	Het
Clcnkb	C	T	4: 141,407,819	R536H	possibly damaging	Het
Col1a1	T	C	11: 94,951,225	M1366T	unknown	Het
Cped1	T	A	6: 22,085,015		probably null	Het
Crip1	G	A	12: 113,153,332	C82Y	probably damaging	Het
Csmd3	T	C	15: 47,657,519	T2810A	possibly damaging	Het
Cyp2b9	A	T	7: 26,198,569	D266V	probably damaging	Het
Cyp46a1	A	G	12: 108,353,126	D294G	probably damaging	Het
Dst	A	G	1: 34,188,843	E1514G	probably benign	Het
Dync1h1	A	G	12: 110,624,636	E1046G	probably benign	Het
Eya2	T	C	2: 165,664,806	V4A	probably benign	Het
Frem3	A	T	8: 80,611,938	R287*	probably null	Het
Fuca2	T	A	10: 13,507,256	C323S	possibly damaging	Het
Ggt7	T	C	2: 155,514,787	E4G	possibly damaging	Het
Gli1	C	T	10: 127,333,737	R383H	probably damaging	Het
Gm4559	C	A	7: 142,274,261	V35F	unknown	Het
Gpm6a	T	A	8: 55,037,330	C14S	probably damaging	Het
Hcn2	A	T	10: 79,726,189	I340F	probably benign	Het
Hdac9	T	A	12: 34,390,333	D349V	probably damaging	Het
Krt34	T	C	11: 100,038,292	D364G	possibly damaging	Het
Mon2	C	T	10: 123,002,885	R1565H	probably damaging	Het
Myb	T	A	10: 21,141,977	M482L	probably benign	Het
Nckap1l	A	T	15: 103,464,601	I294F	probably benign	Het
Nr2e1	A	G	10: 42,568,371		probably null	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1282	A	T	2: 111,335,463	I205N	possibly damaging	Het
Olfr345	G	T	2: 36,640,189	R50M	possibly damaging	Het
Olfr398	T	A	11: 73,984,542	D22V	probably benign	Het
Olfr652	T	C	7: 104,564,911	V230A	possibly damaging	Het
Pde8b	A	T	13: 95,085,215	I308N	possibly damaging	Het
Pdzd2	T	C	15: 12,373,900	R2050G	possibly damaging	Het
Phc3	C	A	3: 30,914,458	S840I	probably damaging	Het
Piezo2	T	A	18: 63,113,960	Y327F	probably damaging	Het
Pnliprp1	A	T	19: 58,744,084	I460F	probably benign	Het
Pphln1	T	G	15: 93,424,046	D35E	probably damaging	Het
Prdm6	G	A	18: 53,568,217	V360I	probably damaging	Het
Rab35	T	A	5: 115,640,160	W62R	probably damaging	Het
Sct	G	T	7: 141,278,699	P70Q	probably damaging	Het
Sdf4	A	G	4: 156,009,847	N328S	probably damaging	Het
Senp5	A	T	16: 31,983,824	S488R	probably damaging	Het
Serpina3n	A	G	12: 104,408,954	E95G	probably benign	Het
Sfswap	C	T	5: 129,541,328	A442V	probably benign	Het
Sgcd	T	C	11: 47,355,241	I45V	probably benign	Het
Sgcg	T	C	14: 61,236,897		probably null	Het
Slc39a12	G	T	2: 14,444,057	V489L	probably benign	Het
Slc5a11	T	A	7: 123,239,448	I96N	possibly damaging	Het
Slc6a12	A	G	6: 121,347,423	D2G	probably damaging	Het
Slc8a1	T	C	17: 81,648,013	D532G	probably damaging	Het
Smarcd3	C	A	5: 24,593,021	C465F	probably damaging	Het
Smc1b	T	A	15: 85,092,067	Q813L	probably benign	Het
Spag1	G	A	15: 36,181,770	E25K	probably damaging	Het
Sptan1	A	T	2: 29,995,528	N715I	probably damaging	Het
Tas1r2	T	A	4: 139,669,695	Y782N	probably damaging	Het
Thap3	A	T	4: 151,983,136	C162S	probably benign	Het
Topaz1	T	A	9: 122,749,619	D531E	possibly damaging	Het
Vmn1r25	C	T	6: 57,978,927	A126T	possibly damaging	Het
Zfhx2	T	C	14: 55,072,749	Y780C	possibly damaging	Het
Zfhx2	A	G	14: 55,065,617	F1637L	probably benign	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het
Zfp956	A	T	6: 47,963,744	T346S	probably benign	Het
Zkscan1	C	T	5: 138,097,148	A219V	probably damaging	Het

Other mutations in Clpb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Clpb	APN	7	101787745	missense	probably benign
IGL00778:Clpb	APN	7	101778608	nonsense	probably null
IGL00780:Clpb	APN	7	101778608	nonsense	probably null
IGL00951:Clpb	APN	7	101751260	missense	probably benign	0.00
IGL01374:Clpb	APN	7	101773128	missense	probably damaging	1.00
IGL01542:Clpb	APN	7	101787505	missense	probably damaging	0.98
IGL02203:Clpb	APN	7	101779337	missense	probably damaging	1.00
IGL02989:Clpb	APN	7	101779220	missense	probably damaging	1.00
IGL03088:Clpb	APN	7	101785449	nonsense	probably null
Surfeit	UTSW	7	101711465	missense	probably damaging	1.00
PIT1430001:Clpb	UTSW	7	101786719	missense	possibly damaging	0.95
PIT4486001:Clpb	UTSW	7	101663932	missense	probably benign	0.17
R0611:Clpb	UTSW	7	101787749	missense	possibly damaging	0.71
R1565:Clpb	UTSW	7	101785461	missense	probably benign	0.00
R1760:Clpb	UTSW	7	101786698	missense	possibly damaging	0.92
R1933:Clpb	UTSW	7	101779211	missense	probably damaging	0.96
R1938:Clpb	UTSW	7	101763656	missense	probably damaging	1.00
R2922:Clpb	UTSW	7	101722828	missense	probably benign	0.02
R2923:Clpb	UTSW	7	101722828	missense	probably benign	0.02
R2995:Clpb	UTSW	7	101779324	missense	probably damaging	1.00
R4492:Clpb	UTSW	7	101787722	missense	probably damaging	1.00
R5384:Clpb	UTSW	7	101779341	missense	probably damaging	1.00
R5973:Clpb	UTSW	7	101663997	missense	probably benign	0.02
R6787:Clpb	UTSW	7	101663659	unclassified	probably benign
R7158:Clpb	UTSW	7	101663832	missense	probably benign	0.45
R7225:Clpb	UTSW	7	101711465	missense	probably damaging	1.00
R7239:Clpb	UTSW	7	101711455	missense	probably damaging	0.96
R7482:Clpb	UTSW	7	101786719	missense	possibly damaging	0.95
R7499:Clpb	UTSW	7	101722728	missense	possibly damaging	0.92
R7547:Clpb	UTSW	7	101664296	splice site	probably null
R7769:Clpb	UTSW	7	101722717	missense	probably damaging	0.96
R8279:Clpb	UTSW	7	101706488	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- GGATTATATTGACCCTCTCAGCC -3'
(R):5'- GCACTGATCAATGCTGGTGG -3'

Sequencing Primer
(F):5'- ATTATATTGACCCTCTCAGCCTTCAC -3'
(R):5'- ATCAATGCTGGTGGGAGCC -3'

Posted On

2014-06-30