Incidental Mutation 'R1879:Myb'
ID211406
Institutional Source Beutler Lab
Gene Symbol Myb
Ensembl Gene ENSMUSG00000019982
Gene Namemyeloblastosis oncogene
Synonymsc-myb
MMRRC Submission 039900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1879 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location21124935-21160984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21141977 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 482 (M482L)
Ref Sequence ENSEMBL: ENSMUSP00000020158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020158] [ENSMUST00000188495]
PDB Structure
CRYSTAL STRUCTURE OF C-MYB R1 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2R3 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF C-MYB R2 V103L MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX1 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX2 [X-RAY DIFFRACTION]
STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, 20 STRUCTURES [SOLUTION NMR]
MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1 [SOLUTION NMR]
MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1 [SOLUTION NMR]
>> 8 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000020158
AA Change: M482L

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020158
Gene: ENSMUSG00000019982
AA Change: M482L

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 267 313 4e-29 PFAM
Pfam:Cmyb_C 399 559 1.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186446
Predicted Effect probably benign
Transcript: ENSMUST00000188495
AA Change: M601L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139699
Gene: ENSMUSG00000019982
AA Change: M601L

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 266 313 3.6e-32 PFAM
low complexity region 409 421 N/A INTRINSIC
Pfam:Cmyb_C 516 682 8.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216985
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for deficient alleles of this gene display severe hematopoietic abnormalities. Red and white blood cells and platelets are all affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,476 D268G possibly damaging Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 T C 8: 79,687,456 N542S probably benign Het
Abcf1 T A 17: 35,961,812 E260D probably benign Het
Ahcy A G 2: 155,064,152 probably null Het
Akap13 C T 7: 75,610,727 A1033V probably benign Het
Alkbh6 A G 7: 30,311,895 N46S probably damaging Het
Ankrd34c A C 9: 89,730,073 L72V probably damaging Het
Arf4 T A 14: 26,646,921 N25K probably damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Cavin1 C A 11: 100,970,210 G86V probably damaging Het
Ces1d G A 8: 93,189,498 T167I probably benign Het
Cfb T C 17: 34,860,560 I754V probably benign Het
Clcnkb C T 4: 141,407,819 R536H possibly damaging Het
Clpb T G 7: 101,706,483 S181R probably benign Het
Col1a1 T C 11: 94,951,225 M1366T unknown Het
Cped1 T A 6: 22,085,015 probably null Het
Crip1 G A 12: 113,153,332 C82Y probably damaging Het
Csmd3 T C 15: 47,657,519 T2810A possibly damaging Het
Cyp2b9 A T 7: 26,198,569 D266V probably damaging Het
Cyp46a1 A G 12: 108,353,126 D294G probably damaging Het
Dst A G 1: 34,188,843 E1514G probably benign Het
Dync1h1 A G 12: 110,624,636 E1046G probably benign Het
Eya2 T C 2: 165,664,806 V4A probably benign Het
Frem3 A T 8: 80,611,938 R287* probably null Het
Fuca2 T A 10: 13,507,256 C323S possibly damaging Het
Ggt7 T C 2: 155,514,787 E4G possibly damaging Het
Gli1 C T 10: 127,333,737 R383H probably damaging Het
Gm4559 C A 7: 142,274,261 V35F unknown Het
Gpm6a T A 8: 55,037,330 C14S probably damaging Het
Hcn2 A T 10: 79,726,189 I340F probably benign Het
Hdac9 T A 12: 34,390,333 D349V probably damaging Het
Krt34 T C 11: 100,038,292 D364G possibly damaging Het
Mon2 C T 10: 123,002,885 R1565H probably damaging Het
Nckap1l A T 15: 103,464,601 I294F probably benign Het
Nr2e1 A G 10: 42,568,371 probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1282 A T 2: 111,335,463 I205N possibly damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr398 T A 11: 73,984,542 D22V probably benign Het
Olfr652 T C 7: 104,564,911 V230A possibly damaging Het
Pde8b A T 13: 95,085,215 I308N possibly damaging Het
Pdzd2 T C 15: 12,373,900 R2050G possibly damaging Het
Phc3 C A 3: 30,914,458 S840I probably damaging Het
Piezo2 T A 18: 63,113,960 Y327F probably damaging Het
Pnliprp1 A T 19: 58,744,084 I460F probably benign Het
Pphln1 T G 15: 93,424,046 D35E probably damaging Het
Prdm6 G A 18: 53,568,217 V360I probably damaging Het
Rab35 T A 5: 115,640,160 W62R probably damaging Het
Sct G T 7: 141,278,699 P70Q probably damaging Het
Sdf4 A G 4: 156,009,847 N328S probably damaging Het
Senp5 A T 16: 31,983,824 S488R probably damaging Het
Serpina3n A G 12: 104,408,954 E95G probably benign Het
Sfswap C T 5: 129,541,328 A442V probably benign Het
Sgcd T C 11: 47,355,241 I45V probably benign Het
Sgcg T C 14: 61,236,897 probably null Het
Slc39a12 G T 2: 14,444,057 V489L probably benign Het
Slc5a11 T A 7: 123,239,448 I96N possibly damaging Het
Slc6a12 A G 6: 121,347,423 D2G probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Smarcd3 C A 5: 24,593,021 C465F probably damaging Het
Smc1b T A 15: 85,092,067 Q813L probably benign Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sptan1 A T 2: 29,995,528 N715I probably damaging Het
Tas1r2 T A 4: 139,669,695 Y782N probably damaging Het
Thap3 A T 4: 151,983,136 C162S probably benign Het
Topaz1 T A 9: 122,749,619 D531E possibly damaging Het
Vmn1r25 C T 6: 57,978,927 A126T possibly damaging Het
Zfhx2 A G 14: 55,065,617 F1637L probably benign Het
Zfhx2 T C 14: 55,072,749 Y780C possibly damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp956 A T 6: 47,963,744 T346S probably benign Het
Zkscan1 C T 5: 138,097,148 A219V probably damaging Het
Other mutations in Myb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Myb APN 10 21141826 missense probably damaging 0.99
IGL00707:Myb APN 10 21148384 missense probably damaging 1.00
IGL00796:Myb APN 10 21141799 missense probably benign 0.00
IGL01012:Myb APN 10 21146260 missense probably benign 0.03
IGL01082:Myb APN 10 21152944 missense probably damaging 1.00
IGL01365:Myb APN 10 21152502 missense probably benign 0.31
IGL01906:Myb APN 10 21152634 missense probably damaging 1.00
IGL02560:Myb APN 10 21152448 missense probably damaging 1.00
Huang_river UTSW 10 21152617 missense probably damaging 1.00
PIT4495001:Myb UTSW 10 21152622 missense probably damaging 0.98
R0385:Myb UTSW 10 21154712 missense possibly damaging 0.73
R0442:Myb UTSW 10 21126196 missense probably benign 0.05
R0759:Myb UTSW 10 21145028 missense probably benign 0.01
R0882:Myb UTSW 10 21156360 missense possibly damaging 0.75
R0920:Myb UTSW 10 21126234 missense possibly damaging 0.80
R1401:Myb UTSW 10 21152945 missense probably damaging 1.00
R1651:Myb UTSW 10 21126198 missense probably damaging 1.00
R1752:Myb UTSW 10 21156437 missense possibly damaging 0.89
R1971:Myb UTSW 10 21140656 missense probably benign 0.00
R4355:Myb UTSW 10 21152617 missense probably damaging 1.00
R4611:Myb UTSW 10 21145324 missense probably damaging 1.00
R4650:Myb UTSW 10 21152941 missense probably damaging 1.00
R4888:Myb UTSW 10 21126238 missense probably benign 0.01
R5121:Myb UTSW 10 21126238 missense probably benign 0.01
R5922:Myb UTSW 10 21152927 missense probably damaging 1.00
R5955:Myb UTSW 10 21152499 missense probably damaging 1.00
R6116:Myb UTSW 10 21154754 missense probably damaging 1.00
R6150:Myb UTSW 10 21141769 missense probably damaging 1.00
R6207:Myb UTSW 10 21145322 missense probably benign
R6656:Myb UTSW 10 21152945 missense probably damaging 1.00
R6801:Myb UTSW 10 21144966 splice site probably null
R6824:Myb UTSW 10 21145120 missense probably benign 0.00
R6884:Myb UTSW 10 21152532 missense probably damaging 1.00
R6977:Myb UTSW 10 21152652 missense probably damaging 0.96
R7562:Myb UTSW 10 21141754 splice site probably null
R7651:Myb UTSW 10 21156374 missense probably damaging 1.00
R7747:Myb UTSW 10 21156425 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGTGGTCCACTCTCTTGAAAC -3'
(R):5'- TCCCTCAATGAATGCATTTGGC -3'

Sequencing Primer
(F):5'- GGTCCACTCTCTTGAAACTCAGC -3'
(R):5'- CCCTCAATGAATGCATTTGGCTAATC -3'
Posted On2014-06-30