Mutagenetix > Incidental Mutations

Incidental Mutation 'R1879:Ntn4'

211410

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

039900-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1879 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 93707353 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 314 (R314W)

Ref Sequence

ENSEMBL: ENSMUSP00000020204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020204
AA Change: R314W

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: R314W

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Meta Mutation Damage Score

0.6651

Coding Region Coverage

1x: 97.3%
3x: 96.6%
10x: 94.9%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,476	D268G	possibly damaging	Het
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abce1	T	C	8: 79,687,456	N542S	probably benign	Het
Abcf1	T	A	17: 35,961,812	E260D	probably benign	Het
Ahcy	A	G	2: 155,064,152		probably null	Het
Akap13	C	T	7: 75,610,727	A1033V	probably benign	Het
Alkbh6	A	G	7: 30,311,895	N46S	probably damaging	Het
Ankrd34c	A	C	9: 89,730,073	L72V	probably damaging	Het
Arf4	T	A	14: 26,646,921	N25K	probably damaging	Het
Arhgef4	A	G	1: 34,722,440	D259G	unknown	Het
Cavin1	C	A	11: 100,970,210	G86V	probably damaging	Het
Ces1d	G	A	8: 93,189,498	T167I	probably benign	Het
Cfb	T	C	17: 34,860,560	I754V	probably benign	Het
Clcnkb	C	T	4: 141,407,819	R536H	possibly damaging	Het
Clpb	T	G	7: 101,706,483	S181R	probably benign	Het
Col1a1	T	C	11: 94,951,225	M1366T	unknown	Het
Cped1	T	A	6: 22,085,015		probably null	Het
Crip1	G	A	12: 113,153,332	C82Y	probably damaging	Het
Csmd3	T	C	15: 47,657,519	T2810A	possibly damaging	Het
Cyp2b9	A	T	7: 26,198,569	D266V	probably damaging	Het
Cyp46a1	A	G	12: 108,353,126	D294G	probably damaging	Het
Dst	A	G	1: 34,188,843	E1514G	probably benign	Het
Dync1h1	A	G	12: 110,624,636	E1046G	probably benign	Het
Eya2	T	C	2: 165,664,806	V4A	probably benign	Het
Frem3	A	T	8: 80,611,938	R287*	probably null	Het
Fuca2	T	A	10: 13,507,256	C323S	possibly damaging	Het
Ggt7	T	C	2: 155,514,787	E4G	possibly damaging	Het
Gli1	C	T	10: 127,333,737	R383H	probably damaging	Het
Gm4559	C	A	7: 142,274,261	V35F	unknown	Het
Gpm6a	T	A	8: 55,037,330	C14S	probably damaging	Het
Hcn2	A	T	10: 79,726,189	I340F	probably benign	Het
Hdac9	T	A	12: 34,390,333	D349V	probably damaging	Het
Krt34	T	C	11: 100,038,292	D364G	possibly damaging	Het
Mon2	C	T	10: 123,002,885	R1565H	probably damaging	Het
Myb	T	A	10: 21,141,977	M482L	probably benign	Het
Nckap1l	A	T	15: 103,464,601	I294F	probably benign	Het
Nr2e1	A	G	10: 42,568,371		probably null	Het
Olfr1282	A	T	2: 111,335,463	I205N	possibly damaging	Het
Olfr345	G	T	2: 36,640,189	R50M	possibly damaging	Het
Olfr398	T	A	11: 73,984,542	D22V	probably benign	Het
Olfr652	T	C	7: 104,564,911	V230A	possibly damaging	Het
Pde8b	A	T	13: 95,085,215	I308N	possibly damaging	Het
Pdzd2	T	C	15: 12,373,900	R2050G	possibly damaging	Het
Phc3	C	A	3: 30,914,458	S840I	probably damaging	Het
Piezo2	T	A	18: 63,113,960	Y327F	probably damaging	Het
Pnliprp1	A	T	19: 58,744,084	I460F	probably benign	Het
Pphln1	T	G	15: 93,424,046	D35E	probably damaging	Het
Prdm6	G	A	18: 53,568,217	V360I	probably damaging	Het
Rab35	T	A	5: 115,640,160	W62R	probably damaging	Het
Sct	G	T	7: 141,278,699	P70Q	probably damaging	Het
Sdf4	A	G	4: 156,009,847	N328S	probably damaging	Het
Senp5	A	T	16: 31,983,824	S488R	probably damaging	Het
Serpina3n	A	G	12: 104,408,954	E95G	probably benign	Het
Sfswap	C	T	5: 129,541,328	A442V	probably benign	Het
Sgcd	T	C	11: 47,355,241	I45V	probably benign	Het
Sgcg	T	C	14: 61,236,897		probably null	Het
Slc39a12	G	T	2: 14,444,057	V489L	probably benign	Het
Slc5a11	T	A	7: 123,239,448	I96N	possibly damaging	Het
Slc6a12	A	G	6: 121,347,423	D2G	probably damaging	Het
Slc8a1	T	C	17: 81,648,013	D532G	probably damaging	Het
Smarcd3	C	A	5: 24,593,021	C465F	probably damaging	Het
Smc1b	T	A	15: 85,092,067	Q813L	probably benign	Het
Spag1	G	A	15: 36,181,770	E25K	probably damaging	Het
Sptan1	A	T	2: 29,995,528	N715I	probably damaging	Het
Tas1r2	T	A	4: 139,669,695	Y782N	probably damaging	Het
Thap3	A	T	4: 151,983,136	C162S	probably benign	Het
Topaz1	T	A	9: 122,749,619	D531E	possibly damaging	Het
Vmn1r25	C	T	6: 57,978,927	A126T	possibly damaging	Het
Zfhx2	A	G	14: 55,065,617	F1637L	probably benign	Het
Zfhx2	T	C	14: 55,072,749	Y780C	possibly damaging	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het
Zfp956	A	T	6: 47,963,744	T346S	probably benign	Het
Zkscan1	C	T	5: 138,097,148	A219V	probably damaging	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0419:Ntn4	UTSW	10	93682429	missense	probably benign	0.04
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1806:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R5818:Ntn4	UTSW	10	93644764	missense	probably benign	0.40
R6048:Ntn4	UTSW	10	93707266	splice site	probably null
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7240:Ntn4	UTSW	10	93745741	missense	probably damaging	0.99
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7374:Ntn4	UTSW	10	93682572	missense	probably benign
R7505:Ntn4	UTSW	10	93707284	missense	probably damaging	1.00
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7726:Ntn4	UTSW	10	93733682	missense	possibly damaging	0.82
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCCTTACAGATAAATGGGTATGAAG -3'
(R):5'- ACATTCTTGGCTACTCAGGCC -3'

Sequencing Primer
(F):5'- AAGAAGTTGAAGGGAGGGTTTCTTTC -3'
(R):5'- ACTGCAGGCTGTTTCCAACG -3'

Posted On

2014-06-30