Incidental Mutation 'R1879:Krt34'
ID 211416
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Name keratin 34
Synonyms 4733401E01Rik, Krt1-4
MMRRC Submission 039900-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1879 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 99928173-99932380 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99929118 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 364 (D364G)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
AlphaFold Q9D646
Predicted Effect possibly damaging
Transcript: ENSMUST00000056362
AA Change: D364G

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: D364G

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,686,488 (GRCm39) D268G possibly damaging Het
Abce1 T C 8: 80,414,085 (GRCm39) N542S probably benign Het
Abcf1 T A 17: 36,272,704 (GRCm39) E260D probably benign Het
Ahcy A G 2: 154,906,072 (GRCm39) probably null Het
Akap13 C T 7: 75,260,475 (GRCm39) A1033V probably benign Het
Alkbh6 A G 7: 30,011,320 (GRCm39) N46S probably damaging Het
Ankrd34c A C 9: 89,612,126 (GRCm39) L72V probably damaging Het
Arf4 T A 14: 26,368,076 (GRCm39) N25K probably damaging Het
Arhgef4 A G 1: 34,761,521 (GRCm39) D259G unknown Het
Cavin1 C A 11: 100,861,036 (GRCm39) G86V probably damaging Het
Ces1d G A 8: 93,916,126 (GRCm39) T167I probably benign Het
Cfb T C 17: 35,079,536 (GRCm39) I754V probably benign Het
Clcnkb C T 4: 141,135,130 (GRCm39) R536H possibly damaging Het
Clpb T G 7: 101,355,690 (GRCm39) S181R probably benign Het
Col1a1 T C 11: 94,842,051 (GRCm39) M1366T unknown Het
Cped1 T A 6: 22,085,014 (GRCm39) probably null Het
Crip1 G A 12: 113,116,952 (GRCm39) C82Y probably damaging Het
Csmd3 T C 15: 47,520,915 (GRCm39) T2810A possibly damaging Het
Cyp2b9 A T 7: 25,897,994 (GRCm39) D266V probably damaging Het
Cyp46a1 A G 12: 108,319,385 (GRCm39) D294G probably damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dst A G 1: 34,227,924 (GRCm39) E1514G probably benign Het
Dync1h1 A G 12: 110,591,070 (GRCm39) E1046G probably benign Het
Eya2 T C 2: 165,506,726 (GRCm39) V4A probably benign Het
Frem3 A T 8: 81,338,567 (GRCm39) R287* probably null Het
Fuca2 T A 10: 13,383,000 (GRCm39) C323S possibly damaging Het
Ggt7 T C 2: 155,356,707 (GRCm39) E4G possibly damaging Het
Gli1 C T 10: 127,169,606 (GRCm39) R383H probably damaging Het
Gm4559 C A 7: 141,827,998 (GRCm39) V35F unknown Het
Gpm6a T A 8: 55,490,365 (GRCm39) C14S probably damaging Het
Hcn2 A T 10: 79,562,023 (GRCm39) I340F probably benign Het
Hdac9 T A 12: 34,440,332 (GRCm39) D349V probably damaging Het
Mon2 C T 10: 122,838,790 (GRCm39) R1565H probably damaging Het
Myb T A 10: 21,017,876 (GRCm39) M482L probably benign Het
Nckap1l A T 15: 103,373,028 (GRCm39) I294F probably benign Het
Nr2e1 A G 10: 42,444,367 (GRCm39) probably null Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or1j16 G T 2: 36,530,201 (GRCm39) R50M possibly damaging Het
Or1r1 T A 11: 73,875,368 (GRCm39) D22V probably benign Het
Or4k38 A T 2: 111,165,808 (GRCm39) I205N possibly damaging Het
Or52h7 T C 7: 104,214,118 (GRCm39) V230A possibly damaging Het
Pde8b A T 13: 95,221,723 (GRCm39) I308N possibly damaging Het
Pdzd2 T C 15: 12,373,986 (GRCm39) R2050G possibly damaging Het
Phc3 C A 3: 30,968,607 (GRCm39) S840I probably damaging Het
Piezo2 T A 18: 63,247,031 (GRCm39) Y327F probably damaging Het
Pnliprp1 A T 19: 58,732,516 (GRCm39) I460F probably benign Het
Pphln1 T G 15: 93,321,927 (GRCm39) D35E probably damaging Het
Prdm6 G A 18: 53,701,289 (GRCm39) V360I probably damaging Het
Rab35 T A 5: 115,778,219 (GRCm39) W62R probably damaging Het
Sct G T 7: 140,858,612 (GRCm39) P70Q probably damaging Het
Sdf4 A G 4: 156,094,304 (GRCm39) N328S probably damaging Het
Senp5 A T 16: 31,802,642 (GRCm39) S488R probably damaging Het
Serpina3n A G 12: 104,375,213 (GRCm39) E95G probably benign Het
Sfswap C T 5: 129,618,392 (GRCm39) A442V probably benign Het
Sgcd T C 11: 47,246,068 (GRCm39) I45V probably benign Het
Sgcg T C 14: 61,474,346 (GRCm39) probably null Het
Slc39a12 G T 2: 14,448,868 (GRCm39) V489L probably benign Het
Slc5a11 T A 7: 122,838,671 (GRCm39) I96N possibly damaging Het
Slc6a12 A G 6: 121,324,382 (GRCm39) D2G probably damaging Het
Slc8a1 T C 17: 81,955,442 (GRCm39) D532G probably damaging Het
Smarcd3 C A 5: 24,798,019 (GRCm39) C465F probably damaging Het
Smc1b T A 15: 84,976,268 (GRCm39) Q813L probably benign Het
Spag1 G A 15: 36,181,916 (GRCm39) E25K probably damaging Het
Sptan1 A T 2: 29,885,540 (GRCm39) N715I probably damaging Het
Tas1r2 T A 4: 139,397,006 (GRCm39) Y782N probably damaging Het
Thap3 A T 4: 152,067,593 (GRCm39) C162S probably benign Het
Topaz1 T A 9: 122,578,684 (GRCm39) D531E possibly damaging Het
Vmn1r25 C T 6: 57,955,912 (GRCm39) A126T possibly damaging Het
Zfhx2 A G 14: 55,303,074 (GRCm39) F1637L probably benign Het
Zfhx2 T C 14: 55,310,206 (GRCm39) Y780C possibly damaging Het
Zfp513 T G 5: 31,357,767 (GRCm39) K202T probably damaging Het
Zfp956 A T 6: 47,940,678 (GRCm39) T346S probably benign Het
Zkscan1 C T 5: 138,095,410 (GRCm39) A219V probably damaging Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 99,929,520 (GRCm39) splice site probably benign
IGL01323:Krt34 APN 11 99,929,606 (GRCm39) missense possibly damaging 0.95
IGL01403:Krt34 APN 11 99,929,116 (GRCm39) missense possibly damaging 0.88
IGL01453:Krt34 APN 11 99,930,916 (GRCm39) missense probably damaging 1.00
IGL02031:Krt34 APN 11 99,929,849 (GRCm39) missense possibly damaging 0.95
IGL02831:Krt34 APN 11 99,930,973 (GRCm39) splice site probably benign
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0220:Krt34 UTSW 11 99,929,519 (GRCm39) splice site probably benign
R0242:Krt34 UTSW 11 99,932,157 (GRCm39) missense probably damaging 1.00
R1573:Krt34 UTSW 11 99,931,854 (GRCm39) missense probably benign 0.01
R1714:Krt34 UTSW 11 99,930,953 (GRCm39) missense possibly damaging 0.95
R3084:Krt34 UTSW 11 99,931,847 (GRCm39) missense probably damaging 1.00
R3692:Krt34 UTSW 11 99,929,857 (GRCm39) missense probably damaging 1.00
R3819:Krt34 UTSW 11 99,930,844 (GRCm39) missense probably damaging 1.00
R3872:Krt34 UTSW 11 99,932,243 (GRCm39) missense probably benign
R3876:Krt34 UTSW 11 99,931,791 (GRCm39) missense probably benign 0.02
R6164:Krt34 UTSW 11 99,929,272 (GRCm39) nonsense probably null
R6338:Krt34 UTSW 11 99,929,316 (GRCm39) missense probably benign 0.00
R6457:Krt34 UTSW 11 99,930,916 (GRCm39) missense probably damaging 1.00
R7728:Krt34 UTSW 11 99,930,811 (GRCm39) critical splice donor site probably null
R7748:Krt34 UTSW 11 99,929,764 (GRCm39) missense probably damaging 1.00
R7903:Krt34 UTSW 11 99,932,321 (GRCm39) start codon destroyed probably null 0.42
R8458:Krt34 UTSW 11 99,930,901 (GRCm39) missense probably damaging 1.00
R8480:Krt34 UTSW 11 99,930,971 (GRCm39) critical splice acceptor site probably null
R9262:Krt34 UTSW 11 99,930,851 (GRCm39) missense probably benign 0.15
R9514:Krt34 UTSW 11 99,929,226 (GRCm39) missense probably damaging 1.00
Z1176:Krt34 UTSW 11 99,932,260 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTGGCAATCTCCCTACCTAC -3'
(R):5'- GAACACCCTGACAGAGAGTG -3'

Sequencing Primer
(F):5'- TGTTGGTAGCTTTCAGAGACAGAAAC -3'
(R):5'- TGAGGCTCGCTACAGCTCTC -3'
Posted On 2014-06-30