Incidental Mutation 'R1879:Crip1'
ID211424
Institutional Source Beutler Lab
Gene Symbol Crip1
Ensembl Gene ENSMUSG00000006360
Gene Namecysteine-rich protein 1 (intestinal)
SynonymsCRP1, Crip
MMRRC Submission 039900-MU
Accession Numbers

Ncbi RefSeq: NM_007763.3; MGI:88501

Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R1879 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113146316-113153879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113153332 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 82 (C82Y)
Ref Sequence ENSEMBL: ENSMUSP00000142803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006523] [ENSMUST00000049271] [ENSMUST00000196755] [ENSMUST00000199089] [ENSMUST00000200522] [ENSMUST00000200553]
Predicted Effect probably damaging
Transcript: ENSMUST00000006523
AA Change: C31Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006523
Gene: ENSMUSG00000006360
AA Change: C31Y

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049271
SMART Domains Protein: ENSMUSP00000035351
Gene: ENSMUSG00000037466

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DUF4509 41 221 4.8e-65 PFAM
low complexity region 233 245 N/A INTRINSIC
Pfam:DUF4510 258 418 3.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196505
Predicted Effect probably benign
Transcript: ENSMUST00000196755
SMART Domains Protein: ENSMUSP00000143431
Gene: ENSMUSG00000037466

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Pfam:DUF4509 40 138 4.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198909
Predicted Effect probably damaging
Transcript: ENSMUST00000199089
AA Change: C82Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142803
Gene: ENSMUSG00000006360
AA Change: C82Y

DomainStartEndE-ValueType
LIM 54 106 9.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199382
Predicted Effect probably benign
Transcript: ENSMUST00000200522
Predicted Effect probably damaging
Transcript: ENSMUST00000200553
AA Change: C31Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143680
Gene: ENSMUSG00000006360
AA Change: C31Y

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cysteine-rich intestinal protein (CRIP) belongs to the LIM/double zinc finger protein family, members of which include cysteine- and glycine-rich protein-1 (CSRP1; MIM 123876), rhombotin-1 (RBTN1; MIM 186921), rhombotin-2 (RBTN2; MIM 180385), and rhombotin-3 (RBTN3; MIM 180386). CRIP may be involved in intestinal zinc transport (Hempe and Cousins, 1991 [PubMed 1946385]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(8) : Targeted(2) Gene trapped(6)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,476 D268G possibly damaging Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 T C 8: 79,687,456 N542S probably benign Het
Abcf1 T A 17: 35,961,812 E260D probably benign Het
Ahcy A G 2: 155,064,152 probably null Het
Akap13 C T 7: 75,610,727 A1033V probably benign Het
Alkbh6 A G 7: 30,311,895 N46S probably damaging Het
Ankrd34c A C 9: 89,730,073 L72V probably damaging Het
Arf4 T A 14: 26,646,921 N25K probably damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Cavin1 C A 11: 100,970,210 G86V probably damaging Het
Ces1d G A 8: 93,189,498 T167I probably benign Het
Cfb T C 17: 34,860,560 I754V probably benign Het
Clcnkb C T 4: 141,407,819 R536H possibly damaging Het
Clpb T G 7: 101,706,483 S181R probably benign Het
Col1a1 T C 11: 94,951,225 M1366T unknown Het
Cped1 T A 6: 22,085,015 probably null Het
Csmd3 T C 15: 47,657,519 T2810A possibly damaging Het
Cyp2b9 A T 7: 26,198,569 D266V probably damaging Het
Cyp46a1 A G 12: 108,353,126 D294G probably damaging Het
Dst A G 1: 34,188,843 E1514G probably benign Het
Dync1h1 A G 12: 110,624,636 E1046G probably benign Het
Eya2 T C 2: 165,664,806 V4A probably benign Het
Frem3 A T 8: 80,611,938 R287* probably null Het
Fuca2 T A 10: 13,507,256 C323S possibly damaging Het
Ggt7 T C 2: 155,514,787 E4G possibly damaging Het
Gli1 C T 10: 127,333,737 R383H probably damaging Het
Gm4559 C A 7: 142,274,261 V35F unknown Het
Gpm6a T A 8: 55,037,330 C14S probably damaging Het
Hcn2 A T 10: 79,726,189 I340F probably benign Het
Hdac9 T A 12: 34,390,333 D349V probably damaging Het
Krt34 T C 11: 100,038,292 D364G possibly damaging Het
Mon2 C T 10: 123,002,885 R1565H probably damaging Het
Myb T A 10: 21,141,977 M482L probably benign Het
Nckap1l A T 15: 103,464,601 I294F probably benign Het
Nr2e1 A G 10: 42,568,371 probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1282 A T 2: 111,335,463 I205N possibly damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr398 T A 11: 73,984,542 D22V probably benign Het
Olfr652 T C 7: 104,564,911 V230A possibly damaging Het
Pde8b A T 13: 95,085,215 I308N possibly damaging Het
Pdzd2 T C 15: 12,373,900 R2050G possibly damaging Het
Phc3 C A 3: 30,914,458 S840I probably damaging Het
Piezo2 T A 18: 63,113,960 Y327F probably damaging Het
Pnliprp1 A T 19: 58,744,084 I460F probably benign Het
Pphln1 T G 15: 93,424,046 D35E probably damaging Het
Prdm6 G A 18: 53,568,217 V360I probably damaging Het
Rab35 T A 5: 115,640,160 W62R probably damaging Het
Sct G T 7: 141,278,699 P70Q probably damaging Het
Sdf4 A G 4: 156,009,847 N328S probably damaging Het
Senp5 A T 16: 31,983,824 S488R probably damaging Het
Serpina3n A G 12: 104,408,954 E95G probably benign Het
Sfswap C T 5: 129,541,328 A442V probably benign Het
Sgcd T C 11: 47,355,241 I45V probably benign Het
Sgcg T C 14: 61,236,897 probably null Het
Slc39a12 G T 2: 14,444,057 V489L probably benign Het
Slc5a11 T A 7: 123,239,448 I96N possibly damaging Het
Slc6a12 A G 6: 121,347,423 D2G probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Smarcd3 C A 5: 24,593,021 C465F probably damaging Het
Smc1b T A 15: 85,092,067 Q813L probably benign Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sptan1 A T 2: 29,995,528 N715I probably damaging Het
Tas1r2 T A 4: 139,669,695 Y782N probably damaging Het
Thap3 A T 4: 151,983,136 C162S probably benign Het
Topaz1 T A 9: 122,749,619 D531E possibly damaging Het
Vmn1r25 C T 6: 57,978,927 A126T possibly damaging Het
Zfhx2 T C 14: 55,072,749 Y780C possibly damaging Het
Zfhx2 A G 14: 55,065,617 F1637L probably benign Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp956 A T 6: 47,963,744 T346S probably benign Het
Zkscan1 C T 5: 138,097,148 A219V probably damaging Het
Other mutations in Crip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Crip1 APN 12 113152135 missense probably damaging 1.00
IGL00562:Crip1 APN 12 113153612 splice site probably null
IGL00563:Crip1 APN 12 113153612 splice site probably null
R0030:Crip1 UTSW 12 113153376 critical splice donor site probably null
R4542:Crip1 UTSW 12 113153489 missense probably damaging 1.00
R5918:Crip1 UTSW 12 113153667 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAGCACCATAGTTGCCCCTAAC -3'
(R):5'- AGTCCGGCAACATACCTTTG -3'

Sequencing Primer
(F):5'- CCTAACCCTCTCTGGAGCAC -3'
(R):5'- TACCTTTGGGCCCAAACATGG -3'
Posted On2014-06-30