Mutagenetix > Incidental Mutations

Incidental Mutation 'R1879:Zfhx2'

211428

Institutional Source

Beutler Lab

Gene Symbol

Zfhx2

Ensembl Gene

ENSMUSG00000040721

Gene Name

zinc finger homeobox 2

Synonyms

zfh-5

MMRRC Submission

039900-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.439) question?

Stock #

R1879 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55060262-55092324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55072749 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 780 (Y780C)

Ref Sequence

ENSEMBL: ENSMUSP00000045156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036328
AA Change: Y780C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: Y780C

Domain	Start	End	E-Value	Type
low complexity region	22	42	N/A	INTRINSIC
ZnF_C2H2	230	252	1.43e1	SMART
low complexity region	333	345	N/A	INTRINSIC
low complexity region	428	439	N/A	INTRINSIC
ZnF_C2H2	446	469	8.94e-3	SMART
ZnF_U1	498	532	6.98e-1	SMART
ZnF_C2H2	501	525	3.21e-4	SMART
ZnF_U1	560	594	1.36e0	SMART
ZnF_C2H2	563	587	3.29e-1	SMART
low complexity region	597	623	N/A	INTRINSIC
ZnF_C2H2	752	776	6.4e0	SMART
ZnF_C2H2	815	839	2.02e-1	SMART
ZnF_U1	861	895	1.78e1	SMART
ZnF_C2H2	864	888	5.34e-1	SMART
ZnF_C2H2	974	997	1.51e1	SMART
ZnF_C2H2	1003	1026	1.51e0	SMART
low complexity region	1087	1103	N/A	INTRINSIC
low complexity region	1106	1126	N/A	INTRINSIC
ZnF_U1	1182	1216	3.42e0	SMART
ZnF_C2H2	1185	1209	8.22e-2	SMART
ZnF_U1	1239	1273	3.73e0	SMART
ZnF_C2H2	1242	1266	6.67e-2	SMART
low complexity region	1277	1304	N/A	INTRINSIC
low complexity region	1314	1326	N/A	INTRINSIC
low complexity region	1332	1346	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
low complexity region	1379	1400	N/A	INTRINSIC
low complexity region	1457	1465	N/A	INTRINSIC
ZnF_C2H2	1474	1497	5.34e0	SMART
low complexity region	1522	1531	N/A	INTRINSIC
low complexity region	1542	1554	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
HOX	1589	1651	1.97e-16	SMART
low complexity region	1656	1665	N/A	INTRINSIC
coiled coil region	1693	1723	N/A	INTRINSIC
ZnF_C2H2	1761	1783	2.53e-2	SMART
low complexity region	1837	1847	N/A	INTRINSIC
HOX	1851	1913	2.34e-18	SMART
low complexity region	1984	1995	N/A	INTRINSIC
low complexity region	2001	2051	N/A	INTRINSIC
HOX	2058	2120	1.52e-17	SMART
ZnF_U1	2136	2170	1.09e1	SMART
ZnF_C2H2	2139	2163	5.4e1	SMART
low complexity region	2328	2354	N/A	INTRINSIC
low complexity region	2385	2426	N/A	INTRINSIC
ZnF_U1	2482	2516	8.31e-1	SMART
ZnF_C2H2	2485	2509	9.46e0	SMART
low complexity region	2523	2538	N/A	INTRINSIC
low complexity region	2553	2562	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176665

SMART Domains

Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

Domain	Start	End	E-Value	Type
ZnF_C2H2	13	37	5.34e-1	SMART
ZnF_C2H2	133	156	1.51e1	SMART
ZnF_C2H2	162	185	1.51e0	SMART
low complexity region	246	262	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
ZnF_C2H2	344	368	8.22e-2	SMART
ZnF_C2H2	401	425	6.67e-2	SMART
low complexity region	436	463	N/A	INTRINSIC
low complexity region	473	485	N/A	INTRINSIC
low complexity region	491	505	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
low complexity region	538	559	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176872

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183750

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183822

SMART Domains

Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

Domain	Start	End	E-Value	Type
PDB:2JMU\|A	5	64	3e-23	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185121

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185430

Coding Region Coverage

1x: 97.3%
3x: 96.6%
10x: 94.9%
20x: 91.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,476	D268G	possibly damaging	Het
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abce1	T	C	8: 79,687,456	N542S	probably benign	Het
Abcf1	T	A	17: 35,961,812	E260D	probably benign	Het
Ahcy	A	G	2: 155,064,152		probably null	Het
Akap13	C	T	7: 75,610,727	A1033V	probably benign	Het
Alkbh6	A	G	7: 30,311,895	N46S	probably damaging	Het
Ankrd34c	A	C	9: 89,730,073	L72V	probably damaging	Het
Arf4	T	A	14: 26,646,921	N25K	probably damaging	Het
Arhgef4	A	G	1: 34,722,440	D259G	unknown	Het
Cavin1	C	A	11: 100,970,210	G86V	probably damaging	Het
Ces1d	G	A	8: 93,189,498	T167I	probably benign	Het
Cfb	T	C	17: 34,860,560	I754V	probably benign	Het
Clcnkb	C	T	4: 141,407,819	R536H	possibly damaging	Het
Clpb	T	G	7: 101,706,483	S181R	probably benign	Het
Col1a1	T	C	11: 94,951,225	M1366T	unknown	Het
Cped1	T	A	6: 22,085,015		probably null	Het
Crip1	G	A	12: 113,153,332	C82Y	probably damaging	Het
Csmd3	T	C	15: 47,657,519	T2810A	possibly damaging	Het
Cyp2b9	A	T	7: 26,198,569	D266V	probably damaging	Het
Cyp46a1	A	G	12: 108,353,126	D294G	probably damaging	Het
Dst	A	G	1: 34,188,843	E1514G	probably benign	Het
Dync1h1	A	G	12: 110,624,636	E1046G	probably benign	Het
Eya2	T	C	2: 165,664,806	V4A	probably benign	Het
Frem3	A	T	8: 80,611,938	R287*	probably null	Het
Fuca2	T	A	10: 13,507,256	C323S	possibly damaging	Het
Ggt7	T	C	2: 155,514,787	E4G	possibly damaging	Het
Gli1	C	T	10: 127,333,737	R383H	probably damaging	Het
Gm4559	C	A	7: 142,274,261	V35F	unknown	Het
Gpm6a	T	A	8: 55,037,330	C14S	probably damaging	Het
Hcn2	A	T	10: 79,726,189	I340F	probably benign	Het
Hdac9	T	A	12: 34,390,333	D349V	probably damaging	Het
Krt34	T	C	11: 100,038,292	D364G	possibly damaging	Het
Mon2	C	T	10: 123,002,885	R1565H	probably damaging	Het
Myb	T	A	10: 21,141,977	M482L	probably benign	Het
Nckap1l	A	T	15: 103,464,601	I294F	probably benign	Het
Nr2e1	A	G	10: 42,568,371		probably null	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1282	A	T	2: 111,335,463	I205N	possibly damaging	Het
Olfr345	G	T	2: 36,640,189	R50M	possibly damaging	Het
Olfr398	T	A	11: 73,984,542	D22V	probably benign	Het
Olfr652	T	C	7: 104,564,911	V230A	possibly damaging	Het
Pde8b	A	T	13: 95,085,215	I308N	possibly damaging	Het
Pdzd2	T	C	15: 12,373,900	R2050G	possibly damaging	Het
Phc3	C	A	3: 30,914,458	S840I	probably damaging	Het
Piezo2	T	A	18: 63,113,960	Y327F	probably damaging	Het
Pnliprp1	A	T	19: 58,744,084	I460F	probably benign	Het
Pphln1	T	G	15: 93,424,046	D35E	probably damaging	Het
Prdm6	G	A	18: 53,568,217	V360I	probably damaging	Het
Rab35	T	A	5: 115,640,160	W62R	probably damaging	Het
Sct	G	T	7: 141,278,699	P70Q	probably damaging	Het
Sdf4	A	G	4: 156,009,847	N328S	probably damaging	Het
Senp5	A	T	16: 31,983,824	S488R	probably damaging	Het
Serpina3n	A	G	12: 104,408,954	E95G	probably benign	Het
Sfswap	C	T	5: 129,541,328	A442V	probably benign	Het
Sgcd	T	C	11: 47,355,241	I45V	probably benign	Het
Sgcg	T	C	14: 61,236,897		probably null	Het
Slc39a12	G	T	2: 14,444,057	V489L	probably benign	Het
Slc5a11	T	A	7: 123,239,448	I96N	possibly damaging	Het
Slc6a12	A	G	6: 121,347,423	D2G	probably damaging	Het
Slc8a1	T	C	17: 81,648,013	D532G	probably damaging	Het
Smarcd3	C	A	5: 24,593,021	C465F	probably damaging	Het
Smc1b	T	A	15: 85,092,067	Q813L	probably benign	Het
Spag1	G	A	15: 36,181,770	E25K	probably damaging	Het
Sptan1	A	T	2: 29,995,528	N715I	probably damaging	Het
Tas1r2	T	A	4: 139,669,695	Y782N	probably damaging	Het
Thap3	A	T	4: 151,983,136	C162S	probably benign	Het
Topaz1	T	A	9: 122,749,619	D531E	possibly damaging	Het
Vmn1r25	C	T	6: 57,978,927	A126T	possibly damaging	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het
Zfp956	A	T	6: 47,963,744	T346S	probably benign	Het
Zkscan1	C	T	5: 138,097,148	A219V	probably damaging	Het

Other mutations in Zfhx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Zfhx2	APN	14	55066565	missense	possibly damaging	0.93
IGL00164:Zfhx2	APN	14	55065026	missense	possibly damaging	0.73
IGL00235:Zfhx2	APN	14	55063257	missense	probably benign	0.11
IGL00925:Zfhx2	APN	14	55073061	missense	probably benign	0.06
IGL01025:Zfhx2	APN	14	55064260	missense	probably damaging	1.00
IGL01061:Zfhx2	APN	14	55073882	missense	possibly damaging	0.96
IGL01486:Zfhx2	APN	14	55067090	missense	probably damaging	1.00
IGL01875:Zfhx2	APN	14	55063915	missense	unknown
IGL01990:Zfhx2	APN	14	55073590	missense	probably damaging	0.99
IGL02097:Zfhx2	APN	14	55062894	missense	probably damaging	1.00
IGL02269:Zfhx2	APN	14	55071936	missense	probably benign	0.00
IGL02488:Zfhx2	APN	14	55065103	missense	possibly damaging	0.72
IGL02624:Zfhx2	APN	14	55066628	missense	probably benign	0.06
IGL03087:Zfhx2	APN	14	55072845	missense	possibly damaging	0.85
PIT4403001:Zfhx2	UTSW	14	55074980	missense	probably benign
R0148:Zfhx2	UTSW	14	55072897	missense	possibly damaging	0.86
R0323:Zfhx2	UTSW	14	55065979	missense	possibly damaging	0.73
R0328:Zfhx2	UTSW	14	55071988	missense	probably benign
R0348:Zfhx2	UTSW	14	55063508	missense	probably damaging	0.99
R0442:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R0533:Zfhx2	UTSW	14	55064090	missense	probably benign	0.23
R0561:Zfhx2	UTSW	14	55065889	missense	probably benign	0.01
R0627:Zfhx2	UTSW	14	55065327	missense	probably benign
R0659:Zfhx2	UTSW	14	55073801	missense	possibly damaging	0.73
R0675:Zfhx2	UTSW	14	55063163	missense	probably damaging	0.99
R1301:Zfhx2	UTSW	14	55063397	missense	probably benign	0.32
R1563:Zfhx2	UTSW	14	55065088	missense	probably benign	0.33
R1607:Zfhx2	UTSW	14	55062985	missense	probably damaging	1.00
R1694:Zfhx2	UTSW	14	55073944	missense	possibly damaging	0.91
R1710:Zfhx2	UTSW	14	55065998	missense	possibly damaging	0.70
R1773:Zfhx2	UTSW	14	55072891	missense	possibly damaging	0.53
R1879:Zfhx2	UTSW	14	55065617	missense	probably benign	0.32
R1933:Zfhx2	UTSW	14	55075238	start gained	probably benign
R1944:Zfhx2	UTSW	14	55074732	missense	probably benign	0.18
R2888:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R2889:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R2915:Zfhx2	UTSW	14	55064557	missense	probably damaging	0.98
R3971:Zfhx2	UTSW	14	55074475	missense	probably benign	0.33
R4082:Zfhx2	UTSW	14	55065205	missense	probably benign
R4134:Zfhx2	UTSW	14	55065143	missense	possibly damaging	0.93
R4231:Zfhx2	UTSW	14	55073534	missense	possibly damaging	0.73
R4675:Zfhx2	UTSW	14	55067221	missense	probably benign	0.03
R4764:Zfhx2	UTSW	14	55066915	missense	possibly damaging	0.96
R4866:Zfhx2	UTSW	14	55065536	missense	possibly damaging	0.73
R4940:Zfhx2	UTSW	14	55066434	missense	possibly damaging	0.53
R5125:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5178:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5554:Zfhx2	UTSW	14	55064317	missense	probably damaging	1.00
R5689:Zfhx2	UTSW	14	55073903	missense	possibly damaging	0.53
R5768:Zfhx2	UTSW	14	55074365	missense	probably benign
R5792:Zfhx2	UTSW	14	55066846	missense	possibly damaging	0.72
R5834:Zfhx2	UTSW	14	55073330	nonsense	probably null
R5895:Zfhx2	UTSW	14	55065891	missense	probably benign
R5999:Zfhx2	UTSW	14	55074005	missense	probably benign
R6025:Zfhx2	UTSW	14	55065208	missense	probably benign	0.00
R6106:Zfhx2	UTSW	14	55068310	critical splice acceptor site	probably null
R6135:Zfhx2	UTSW	14	55074196	missense	possibly damaging	0.85
R6186:Zfhx2	UTSW	14	55063160	missense	probably damaging	0.99
R6379:Zfhx2	UTSW	14	55074338	missense	probably benign
R6725:Zfhx2	UTSW	14	55064082	nonsense	probably null
R7089:Zfhx2	UTSW	14	55065772	missense	probably benign	0.33
R7383:Zfhx2	UTSW	14	55068253	missense	probably benign	0.00
R7470:Zfhx2	UTSW	14	55066750	missense	possibly damaging	0.52
R7606:Zfhx2	UTSW	14	55066663	missense	probably benign	0.12
R7607:Zfhx2	UTSW	14	55066231	missense	possibly damaging	0.86
R7698:Zfhx2	UTSW	14	55062849	missense	probably benign	0.00
R7730:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R8142:Zfhx2	UTSW	14	55073438	missense	possibly damaging	0.86
R8188:Zfhx2	UTSW	14	55064441	missense	probably benign	0.18
R8212:Zfhx2	UTSW	14	55072916	missense	possibly damaging	0.70
R8264:Zfhx2	UTSW	14	55065512	missense	possibly damaging	0.53
R8331:Zfhx2	UTSW	14	55071987	missense	probably benign	0.00
R8369:Zfhx2	UTSW	14	55066744	missense	probably benign	0.05
R8371:Zfhx2	UTSW	14	55064092	missense	probably damaging	0.99
R8383:Zfhx2	UTSW	14	55074071	missense	possibly damaging	0.73
R8415:Zfhx2	UTSW	14	55070622	missense	probably benign
R8441:Zfhx2	UTSW	14	55066528	missense	possibly damaging	0.96
R8504:Zfhx2	UTSW	14	55065786	missense	probably benign	0.00
X0065:Zfhx2	UTSW	14	55066960	missense	probably benign	0.33
Z1088:Zfhx2	UTSW	14	55074180	missense	possibly damaging	0.73
Z1177:Zfhx2	UTSW	14	55065920	missense	probably benign	0.40
Z1177:Zfhx2	UTSW	14	55066982	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TTTTCTTCGTGGGCTGAACC -3'
(R):5'- ATCTGCCACCAAGTCAGCTC -3'

Sequencing Primer
(F):5'- TGAACCCCGGGTGTGCAG -3'
(R):5'- TGTGCCAGGCTTTCAGC -3'

Posted On

2014-06-30