Incidental Mutation 'R1879:Pdzd2'
ID211430
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 039900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1879 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12373900 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 2050 (R2050G)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075317
AA Change: R2050G

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: R2050G

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,476 D268G possibly damaging Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 T C 8: 79,687,456 N542S probably benign Het
Abcf1 T A 17: 35,961,812 E260D probably benign Het
Ahcy A G 2: 155,064,152 probably null Het
Akap13 C T 7: 75,610,727 A1033V probably benign Het
Alkbh6 A G 7: 30,311,895 N46S probably damaging Het
Ankrd34c A C 9: 89,730,073 L72V probably damaging Het
Arf4 T A 14: 26,646,921 N25K probably damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Cavin1 C A 11: 100,970,210 G86V probably damaging Het
Ces1d G A 8: 93,189,498 T167I probably benign Het
Cfb T C 17: 34,860,560 I754V probably benign Het
Clcnkb C T 4: 141,407,819 R536H possibly damaging Het
Clpb T G 7: 101,706,483 S181R probably benign Het
Col1a1 T C 11: 94,951,225 M1366T unknown Het
Cped1 T A 6: 22,085,015 probably null Het
Crip1 G A 12: 113,153,332 C82Y probably damaging Het
Csmd3 T C 15: 47,657,519 T2810A possibly damaging Het
Cyp2b9 A T 7: 26,198,569 D266V probably damaging Het
Cyp46a1 A G 12: 108,353,126 D294G probably damaging Het
Dst A G 1: 34,188,843 E1514G probably benign Het
Dync1h1 A G 12: 110,624,636 E1046G probably benign Het
Eya2 T C 2: 165,664,806 V4A probably benign Het
Frem3 A T 8: 80,611,938 R287* probably null Het
Fuca2 T A 10: 13,507,256 C323S possibly damaging Het
Ggt7 T C 2: 155,514,787 E4G possibly damaging Het
Gli1 C T 10: 127,333,737 R383H probably damaging Het
Gm4559 C A 7: 142,274,261 V35F unknown Het
Gpm6a T A 8: 55,037,330 C14S probably damaging Het
Hcn2 A T 10: 79,726,189 I340F probably benign Het
Hdac9 T A 12: 34,390,333 D349V probably damaging Het
Krt34 T C 11: 100,038,292 D364G possibly damaging Het
Mon2 C T 10: 123,002,885 R1565H probably damaging Het
Myb T A 10: 21,141,977 M482L probably benign Het
Nckap1l A T 15: 103,464,601 I294F probably benign Het
Nr2e1 A G 10: 42,568,371 probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1282 A T 2: 111,335,463 I205N possibly damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr398 T A 11: 73,984,542 D22V probably benign Het
Olfr652 T C 7: 104,564,911 V230A possibly damaging Het
Pde8b A T 13: 95,085,215 I308N possibly damaging Het
Phc3 C A 3: 30,914,458 S840I probably damaging Het
Piezo2 T A 18: 63,113,960 Y327F probably damaging Het
Pnliprp1 A T 19: 58,744,084 I460F probably benign Het
Pphln1 T G 15: 93,424,046 D35E probably damaging Het
Prdm6 G A 18: 53,568,217 V360I probably damaging Het
Rab35 T A 5: 115,640,160 W62R probably damaging Het
Sct G T 7: 141,278,699 P70Q probably damaging Het
Sdf4 A G 4: 156,009,847 N328S probably damaging Het
Senp5 A T 16: 31,983,824 S488R probably damaging Het
Serpina3n A G 12: 104,408,954 E95G probably benign Het
Sfswap C T 5: 129,541,328 A442V probably benign Het
Sgcd T C 11: 47,355,241 I45V probably benign Het
Sgcg T C 14: 61,236,897 probably null Het
Slc39a12 G T 2: 14,444,057 V489L probably benign Het
Slc5a11 T A 7: 123,239,448 I96N possibly damaging Het
Slc6a12 A G 6: 121,347,423 D2G probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Smarcd3 C A 5: 24,593,021 C465F probably damaging Het
Smc1b T A 15: 85,092,067 Q813L probably benign Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sptan1 A T 2: 29,995,528 N715I probably damaging Het
Tas1r2 T A 4: 139,669,695 Y782N probably damaging Het
Thap3 A T 4: 151,983,136 C162S probably benign Het
Topaz1 T A 9: 122,749,619 D531E possibly damaging Het
Vmn1r25 C T 6: 57,978,927 A126T possibly damaging Het
Zfhx2 A G 14: 55,065,617 F1637L probably benign Het
Zfhx2 T C 14: 55,072,749 Y780C possibly damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp956 A T 6: 47,963,744 T346S probably benign Het
Zkscan1 C T 5: 138,097,148 A219V probably damaging Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 unclassified probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGACCAACGCATTTCCTGTTC -3'
(R):5'- GCTAACTCTGGGTCAGTGAG -3'

Sequencing Primer
(F):5'- ATTTCCTGTTCCCCCTGGG -3'
(R):5'- TCGAGGACCAATATAGCCTTGGC -3'
Posted On2014-06-30