Incidental Mutation 'R1879:Cfb'
ID211438
Institutional Source Beutler Lab
Gene Symbol Cfb
Ensembl Gene ENSMUSG00000090231
Gene Namecomplement factor B
SynonymsFB, Factor B, B, alternative-complement pathway C3/C5 convertase, Bf, H2-Bf
MMRRC Submission 039900-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1879 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34856374-34862518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34860560 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 754 (I754V)
Ref Sequence ENSEMBL: ENSMUSP00000117677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000025230] [ENSMUST00000097343] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417] [ENSMUST00000153400] [ENSMUST00000154526] [ENSMUST00000165953] [ENSMUST00000173357] [ENSMUST00000176203]
Predicted Effect probably benign
Transcript: ENSMUST00000025229
AA Change: I241V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231
AA Change: I241V

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025230
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097343
SMART Domains Protein: ENSMUSP00000094956
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127795
Predicted Effect probably benign
Transcript: ENSMUST00000128767
AA Change: I239V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231
AA Change: I239V

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129891
AA Change: I448V
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511
AA Change: I448V

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134300
SMART Domains Protein: ENSMUSP00000114241
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
Tryp_SPc 3 148 6.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146299
AA Change: I754V

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511
AA Change: I754V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152417
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153400
SMART Domains Protein: ENSMUSP00000116497
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 1 217 2.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154526
AA Change: I239V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231
AA Change: I239V

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165953
SMART Domains Protein: ENSMUSP00000131195
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173357
SMART Domains Protein: ENSMUSP00000134272
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176203
AA Change: I241V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231
AA Change: I241V

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184774
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations lack the alternative complement pathway, and have reduced overall complement activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,476 D268G possibly damaging Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 T C 8: 79,687,456 N542S probably benign Het
Abcf1 T A 17: 35,961,812 E260D probably benign Het
Ahcy A G 2: 155,064,152 probably null Het
Akap13 C T 7: 75,610,727 A1033V probably benign Het
Alkbh6 A G 7: 30,311,895 N46S probably damaging Het
Ankrd34c A C 9: 89,730,073 L72V probably damaging Het
Arf4 T A 14: 26,646,921 N25K probably damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Cavin1 C A 11: 100,970,210 G86V probably damaging Het
Ces1d G A 8: 93,189,498 T167I probably benign Het
Clcnkb C T 4: 141,407,819 R536H possibly damaging Het
Clpb T G 7: 101,706,483 S181R probably benign Het
Col1a1 T C 11: 94,951,225 M1366T unknown Het
Cped1 T A 6: 22,085,015 probably null Het
Crip1 G A 12: 113,153,332 C82Y probably damaging Het
Csmd3 T C 15: 47,657,519 T2810A possibly damaging Het
Cyp2b9 A T 7: 26,198,569 D266V probably damaging Het
Cyp46a1 A G 12: 108,353,126 D294G probably damaging Het
Dst A G 1: 34,188,843 E1514G probably benign Het
Dync1h1 A G 12: 110,624,636 E1046G probably benign Het
Eya2 T C 2: 165,664,806 V4A probably benign Het
Frem3 A T 8: 80,611,938 R287* probably null Het
Fuca2 T A 10: 13,507,256 C323S possibly damaging Het
Ggt7 T C 2: 155,514,787 E4G possibly damaging Het
Gli1 C T 10: 127,333,737 R383H probably damaging Het
Gm4559 C A 7: 142,274,261 V35F unknown Het
Gpm6a T A 8: 55,037,330 C14S probably damaging Het
Hcn2 A T 10: 79,726,189 I340F probably benign Het
Hdac9 T A 12: 34,390,333 D349V probably damaging Het
Krt34 T C 11: 100,038,292 D364G possibly damaging Het
Mon2 C T 10: 123,002,885 R1565H probably damaging Het
Myb T A 10: 21,141,977 M482L probably benign Het
Nckap1l A T 15: 103,464,601 I294F probably benign Het
Nr2e1 A G 10: 42,568,371 probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1282 A T 2: 111,335,463 I205N possibly damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr398 T A 11: 73,984,542 D22V probably benign Het
Olfr652 T C 7: 104,564,911 V230A possibly damaging Het
Pde8b A T 13: 95,085,215 I308N possibly damaging Het
Pdzd2 T C 15: 12,373,900 R2050G possibly damaging Het
Phc3 C A 3: 30,914,458 S840I probably damaging Het
Piezo2 T A 18: 63,113,960 Y327F probably damaging Het
Pnliprp1 A T 19: 58,744,084 I460F probably benign Het
Pphln1 T G 15: 93,424,046 D35E probably damaging Het
Prdm6 G A 18: 53,568,217 V360I probably damaging Het
Rab35 T A 5: 115,640,160 W62R probably damaging Het
Sct G T 7: 141,278,699 P70Q probably damaging Het
Sdf4 A G 4: 156,009,847 N328S probably damaging Het
Senp5 A T 16: 31,983,824 S488R probably damaging Het
Serpina3n A G 12: 104,408,954 E95G probably benign Het
Sfswap C T 5: 129,541,328 A442V probably benign Het
Sgcd T C 11: 47,355,241 I45V probably benign Het
Sgcg T C 14: 61,236,897 probably null Het
Slc39a12 G T 2: 14,444,057 V489L probably benign Het
Slc5a11 T A 7: 123,239,448 I96N possibly damaging Het
Slc6a12 A G 6: 121,347,423 D2G probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Smarcd3 C A 5: 24,593,021 C465F probably damaging Het
Smc1b T A 15: 85,092,067 Q813L probably benign Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sptan1 A T 2: 29,995,528 N715I probably damaging Het
Tas1r2 T A 4: 139,669,695 Y782N probably damaging Het
Thap3 A T 4: 151,983,136 C162S probably benign Het
Topaz1 T A 9: 122,749,619 D531E possibly damaging Het
Vmn1r25 C T 6: 57,978,927 A126T possibly damaging Het
Zfhx2 A G 14: 55,065,617 F1637L probably benign Het
Zfhx2 T C 14: 55,072,749 Y780C possibly damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp956 A T 6: 47,963,744 T346S probably benign Het
Zkscan1 C T 5: 138,097,148 A219V probably damaging Het
Other mutations in Cfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Cfb UTSW 17 34860386 missense possibly damaging 0.92
R0419:Cfb UTSW 17 34858509 missense probably damaging 1.00
R0514:Cfb UTSW 17 34860898 missense probably damaging 1.00
R0645:Cfb UTSW 17 34860016 missense probably benign 0.25
R0668:Cfb UTSW 17 34857103 missense probably benign 0.29
R0893:Cfb UTSW 17 34858055 missense probably damaging 1.00
R2135:Cfb UTSW 17 34857278 missense possibly damaging 0.84
R3107:Cfb UTSW 17 34861824 missense possibly damaging 0.88
R4291:Cfb UTSW 17 34861138 missense possibly damaging 0.95
R4369:Cfb UTSW 17 34860314 missense probably damaging 1.00
R4371:Cfb UTSW 17 34860314 missense probably damaging 1.00
R4616:Cfb UTSW 17 34859068 missense probably benign 0.29
R5177:Cfb UTSW 17 34859026 missense probably damaging 1.00
R5689:Cfb UTSW 17 34861794 missense probably benign 0.00
R5773:Cfb UTSW 17 34857272 nonsense probably null
R6046:Cfb UTSW 17 34862102 unclassified probably null
R6274:Cfb UTSW 17 34862093 missense probably benign 0.18
R6318:Cfb UTSW 17 34861824 missense possibly damaging 0.88
R7035:Cfb UTSW 17 34860031 missense possibly damaging 0.53
R7585:Cfb UTSW 17 34857761 missense probably benign 0.00
RF005:Cfb UTSW 17 34858046 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGGTCTAGGACAATCTTCCTCTTC -3'
(R):5'- TGTCAAGAAGGTGGCTCATGG -3'

Sequencing Primer
(F):5'- CTGCTGTTCTCCTAGGTGCCAG -3'
(R):5'- CATGGAGTGGGACAGAGCCTTC -3'
Posted On2014-06-30