Mutagenetix > Incidental Mutations

Incidental Mutation 'R1879:Slc8a1'

211441

Institutional Source

Beutler Lab

Gene Symbol

Slc8a1

Ensembl Gene

ENSMUSG00000054640

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 1

Synonyms

Ncx1, D930008O12Rik

MMRRC Submission

039900-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1879 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81388691-81649607 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81648013 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 532 (D532G)

Ref Sequence

ENSEMBL: ENSMUSP00000126373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086538] [ENSMUST00000163123] [ENSMUST00000163680]

Predicted Effect

probably damaging
Transcript: ENSMUST00000086538
AA Change: D532G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083725
Gene: ENSMUSG00000054640
AA Change: D532G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	77	248	3.8e-38	PFAM
Pfam:Na_Ca_ex_C	251	386	2e-53	PFAM
Calx_beta	393	493	1.28e-49	SMART
Calx_beta	524	624	8.25e-44	SMART
low complexity region	754	765	N/A	INTRINSIC
Pfam:Na_Ca_ex	796	961	2.4e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163123
AA Change: D532G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132809
Gene: ENSMUSG00000054640
AA Change: D532G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	87	246	4.6e-38	PFAM
coiled coil region	313	332	N/A	INTRINSIC
Calx_beta	393	493	1.28e-49	SMART
Calx_beta	524	624	8.25e-44	SMART
low complexity region	742	753	N/A	INTRINSIC
Pfam:Na_Ca_ex	794	947	1.2e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163680
AA Change: D532G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126373
Gene: ENSMUSG00000054640
AA Change: D532G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	77	248	3.8e-38	PFAM
Pfam:Na_Ca_ex_C	251	386	2e-53	PFAM
Calx_beta	393	493	1.28e-49	SMART
Calx_beta	524	624	8.25e-44	SMART
low complexity region	754	765	N/A	INTRINSIC
Pfam:Na_Ca_ex	796	961	2.4e-29	PFAM

Coding Region Coverage

1x: 97.3%
3x: 96.6%
10x: 94.9%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In cardiac myocytes, Ca(2+) concentrations alternate between high levels during contraction and low levels during relaxation. The increase in Ca(2+) concentration during contraction is primarily due to release of Ca(2+) from intracellular stores. However, some Ca(2+) also enters the cell through the sarcolemma (plasma membrane). During relaxation, Ca(2+) is sequestered within the intracellular stores. To prevent overloading of intracellular stores, the Ca(2+) that entered across the sarcolemma must be extruded from the cell. The Na(+)-Ca(2+) exchanger is the primary mechanism by which the Ca(2+) is extruded from the cell during relaxation. In the heart, the exchanger may play a key role in digitalis action. The exchanger is the dominant mechanism in returning the cardiac myocyte to its resting state following excitation.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for targeted null mutations have underdeveloped, nonbeating hearts with massive apoptosis of myocytes, a dilated pericardium and die around embryonic day 9.5. Heterozygotes exhibit altered responses to experimental cardiac pressure overload. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	T	C	2: 30,796,476	D268G	possibly damaging	Het
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abce1	T	C	8: 79,687,456	N542S	probably benign	Het
Abcf1	T	A	17: 35,961,812	E260D	probably benign	Het
Ahcy	A	G	2: 155,064,152		probably null	Het
Akap13	C	T	7: 75,610,727	A1033V	probably benign	Het
Alkbh6	A	G	7: 30,311,895	N46S	probably damaging	Het
Ankrd34c	A	C	9: 89,730,073	L72V	probably damaging	Het
Arf4	T	A	14: 26,646,921	N25K	probably damaging	Het
Arhgef4	A	G	1: 34,722,440	D259G	unknown	Het
Cavin1	C	A	11: 100,970,210	G86V	probably damaging	Het
Ces1d	G	A	8: 93,189,498	T167I	probably benign	Het
Cfb	T	C	17: 34,860,560	I754V	probably benign	Het
Clcnkb	C	T	4: 141,407,819	R536H	possibly damaging	Het
Clpb	T	G	7: 101,706,483	S181R	probably benign	Het
Col1a1	T	C	11: 94,951,225	M1366T	unknown	Het
Cped1	T	A	6: 22,085,015		probably null	Het
Crip1	G	A	12: 113,153,332	C82Y	probably damaging	Het
Csmd3	T	C	15: 47,657,519	T2810A	possibly damaging	Het
Cyp2b9	A	T	7: 26,198,569	D266V	probably damaging	Het
Cyp46a1	A	G	12: 108,353,126	D294G	probably damaging	Het
Dst	A	G	1: 34,188,843	E1514G	probably benign	Het
Dync1h1	A	G	12: 110,624,636	E1046G	probably benign	Het
Eya2	T	C	2: 165,664,806	V4A	probably benign	Het
Frem3	A	T	8: 80,611,938	R287*	probably null	Het
Fuca2	T	A	10: 13,507,256	C323S	possibly damaging	Het
Ggt7	T	C	2: 155,514,787	E4G	possibly damaging	Het
Gli1	C	T	10: 127,333,737	R383H	probably damaging	Het
Gm4559	C	A	7: 142,274,261	V35F	unknown	Het
Gpm6a	T	A	8: 55,037,330	C14S	probably damaging	Het
Hcn2	A	T	10: 79,726,189	I340F	probably benign	Het
Hdac9	T	A	12: 34,390,333	D349V	probably damaging	Het
Krt34	T	C	11: 100,038,292	D364G	possibly damaging	Het
Mon2	C	T	10: 123,002,885	R1565H	probably damaging	Het
Myb	T	A	10: 21,141,977	M482L	probably benign	Het
Nckap1l	A	T	15: 103,464,601	I294F	probably benign	Het
Nr2e1	A	G	10: 42,568,371		probably null	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1282	A	T	2: 111,335,463	I205N	possibly damaging	Het
Olfr345	G	T	2: 36,640,189	R50M	possibly damaging	Het
Olfr398	T	A	11: 73,984,542	D22V	probably benign	Het
Olfr652	T	C	7: 104,564,911	V230A	possibly damaging	Het
Pde8b	A	T	13: 95,085,215	I308N	possibly damaging	Het
Pdzd2	T	C	15: 12,373,900	R2050G	possibly damaging	Het
Phc3	C	A	3: 30,914,458	S840I	probably damaging	Het
Piezo2	T	A	18: 63,113,960	Y327F	probably damaging	Het
Pnliprp1	A	T	19: 58,744,084	I460F	probably benign	Het
Pphln1	T	G	15: 93,424,046	D35E	probably damaging	Het
Prdm6	G	A	18: 53,568,217	V360I	probably damaging	Het
Rab35	T	A	5: 115,640,160	W62R	probably damaging	Het
Sct	G	T	7: 141,278,699	P70Q	probably damaging	Het
Sdf4	A	G	4: 156,009,847	N328S	probably damaging	Het
Senp5	A	T	16: 31,983,824	S488R	probably damaging	Het
Serpina3n	A	G	12: 104,408,954	E95G	probably benign	Het
Sfswap	C	T	5: 129,541,328	A442V	probably benign	Het
Sgcd	T	C	11: 47,355,241	I45V	probably benign	Het
Sgcg	T	C	14: 61,236,897		probably null	Het
Slc39a12	G	T	2: 14,444,057	V489L	probably benign	Het
Slc5a11	T	A	7: 123,239,448	I96N	possibly damaging	Het
Slc6a12	A	G	6: 121,347,423	D2G	probably damaging	Het
Smarcd3	C	A	5: 24,593,021	C465F	probably damaging	Het
Smc1b	T	A	15: 85,092,067	Q813L	probably benign	Het
Spag1	G	A	15: 36,181,770	E25K	probably damaging	Het
Sptan1	A	T	2: 29,995,528	N715I	probably damaging	Het
Tas1r2	T	A	4: 139,669,695	Y782N	probably damaging	Het
Thap3	A	T	4: 151,983,136	C162S	probably benign	Het
Topaz1	T	A	9: 122,749,619	D531E	possibly damaging	Het
Vmn1r25	C	T	6: 57,978,927	A126T	possibly damaging	Het
Zfhx2	A	G	14: 55,065,617	F1637L	probably benign	Het
Zfhx2	T	C	14: 55,072,749	Y780C	possibly damaging	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het
Zfp956	A	T	6: 47,963,744	T346S	probably benign	Het
Zkscan1	C	T	5: 138,097,148	A219V	probably damaging	Het

Other mutations in Slc8a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00549:Slc8a1	APN	17	81649171	missense	probably damaging	1.00
IGL00572:Slc8a1	APN	17	81388726	missense	probably damaging	1.00
IGL00777:Slc8a1	APN	17	81648580	missense	probably damaging	1.00
IGL00857:Slc8a1	APN	17	81647879	missense	probably benign	0.03
IGL01068:Slc8a1	APN	17	81388942	missense	probably benign	0.09
IGL01089:Slc8a1	APN	17	81648281	missense	probably damaging	1.00
IGL01089:Slc8a1	APN	17	81388881	missense	probably damaging	1.00
IGL01510:Slc8a1	APN	17	81648365	missense	probably damaging	1.00
IGL01677:Slc8a1	APN	17	81648607	missense	probably damaging	1.00
IGL01862:Slc8a1	APN	17	81442201	critical splice donor site	probably null
IGL02003:Slc8a1	APN	17	81428196	missense	possibly damaging	0.80
IGL02500:Slc8a1	APN	17	81388713	missense	probably damaging	1.00
IGL02556:Slc8a1	APN	17	81648744	missense	probably benign	0.24
IGL02800:Slc8a1	APN	17	81408323	missense	probably benign	0.01
IGL03308:Slc8a1	APN	17	81442195	unclassified	probably benign
IGL03391:Slc8a1	APN	17	81432638	splice site	probably benign
cardinal	UTSW	17	81648407	missense	probably damaging	0.99
encyclical	UTSW	17	81649454	missense	probably damaging	1.00
PIT4498001:Slc8a1	UTSW	17	81648840	nonsense	probably null
R0067:Slc8a1	UTSW	17	81437759	missense	probably benign	0.00
R0067:Slc8a1	UTSW	17	81437759	missense	probably benign	0.00
R0485:Slc8a1	UTSW	17	81647993	missense	probably damaging	0.99
R0667:Slc8a1	UTSW	17	81648881	missense	probably damaging	1.00
R0845:Slc8a1	UTSW	17	81437748	missense	probably benign	0.05
R1073:Slc8a1	UTSW	17	81648407	missense	probably damaging	0.99
R1417:Slc8a1	UTSW	17	81408280	missense	probably damaging	1.00
R1510:Slc8a1	UTSW	17	81648118	missense	probably damaging	1.00
R1546:Slc8a1	UTSW	17	81648247	missense	probably damaging	1.00
R1625:Slc8a1	UTSW	17	81649241	missense	probably damaging	1.00
R1806:Slc8a1	UTSW	17	81648487	missense	probably damaging	1.00
R2025:Slc8a1	UTSW	17	81649112	missense	probably damaging	1.00
R2187:Slc8a1	UTSW	17	81648553	missense	possibly damaging	0.48
R2198:Slc8a1	UTSW	17	81408256	nonsense	probably null
R3856:Slc8a1	UTSW	17	81648374	missense	probably benign
R4067:Slc8a1	UTSW	17	81648274	missense	probably damaging	1.00
R4224:Slc8a1	UTSW	17	81649352	missense	probably damaging	1.00
R4225:Slc8a1	UTSW	17	81649352	missense	probably damaging	1.00
R5028:Slc8a1	UTSW	17	81649273	missense	possibly damaging	0.91
R5307:Slc8a1	UTSW	17	81649224	missense	probably damaging	1.00
R5766:Slc8a1	UTSW	17	81648961	missense	probably damaging	0.97
R5787:Slc8a1	UTSW	17	81388737	missense	probably damaging	1.00
R5902:Slc8a1	UTSW	17	81408082	missense	probably damaging	1.00
R5913:Slc8a1	UTSW	17	81648002	missense	probably damaging	1.00
R6017:Slc8a1	UTSW	17	81648254	missense	probably damaging	1.00
R6481:Slc8a1	UTSW	17	81388918	missense	probably benign
R6670:Slc8a1	UTSW	17	81649454	missense	probably damaging	1.00
R6714:Slc8a1	UTSW	17	81408249	missense	probably damaging	1.00
R6914:Slc8a1	UTSW	17	81408120	missense	probably damaging	1.00
R6919:Slc8a1	UTSW	17	81388872	missense	probably damaging	1.00
R6942:Slc8a1	UTSW	17	81408120	missense	probably damaging	1.00
R7057:Slc8a1	UTSW	17	81649095	missense	probably damaging	1.00
R7431:Slc8a1	UTSW	17	81441663	missense	probably benign	0.00
R7447:Slc8a1	UTSW	17	81649006	missense	probably damaging	1.00
R7480:Slc8a1	UTSW	17	81649220	missense	probably damaging	1.00
R7572:Slc8a1	UTSW	17	81441771	critical splice donor site	probably null
R8056:Slc8a1	UTSW	17	81647923	missense	probably damaging	1.00
R8326:Slc8a1	UTSW	17	81408106	missense	probably damaging	0.98
X0024:Slc8a1	UTSW	17	81432762	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CCACAGGTGTCCTCAAAGTCTTC -3'
(R):5'- ACGGAAGGGACTGTGATCTTC -3'

Sequencing Primer
(F):5'- GGTGTCCTCAAAGTCTTCCCCTC -3'
(R):5'- CTGTGATCTTCAAACCAGGGG -3'

Posted On

2014-06-30