Incidental Mutation 'R1891:Cog6'
ID211460
Institutional Source Beutler Lab
Gene Symbol Cog6
Ensembl Gene ENSMUSG00000027742
Gene Namecomponent of oligomeric golgi complex 6
Synonyms
MMRRC Submission 039911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1891 (G1)
Quality Score203
Status Not validated
Chromosome3
Chromosomal Location52981875-53017237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52983180 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 613 (I613R)
Ref Sequence ENSEMBL: ENSMUSP00000048603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432]
Predicted Effect probably benign
Transcript: ENSMUST00000036665
AA Change: I613R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: I613R

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 656 N/A SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193432
SMART Domains Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 625 5e-289 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194779
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,033 M135K possibly damaging Het
Abca7 T C 10: 80,005,040 I921T possibly damaging Het
Abca8a T C 11: 110,091,607 K3R probably benign Het
Adgrl3 A T 5: 81,512,044 D152V probably damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Akt1 A G 12: 112,659,575 F88L probably damaging Het
Ankrd24 T C 10: 81,643,508 probably benign Het
Arid4b T A 13: 14,136,236 N141K possibly damaging Het
Cacna1c C A 6: 118,776,519 D219Y probably damaging Het
Ccdc113 A G 8: 95,540,916 K170E probably damaging Het
Ccdc151 G T 9: 21,995,381 probably null Het
Ceacam9 A G 7: 16,723,955 E136G probably damaging Het
Cfap43 A G 19: 47,813,941 L333P probably damaging Het
Chl1 A G 6: 103,714,583 D1062G possibly damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clpp T A 17: 56,991,307 V91E probably damaging Het
Cndp1 A T 18: 84,619,633 H325Q probably null Het
Cngb3 A G 4: 19,366,446 N169S probably benign Het
Creb3l1 A G 2: 91,987,040 L376P probably damaging Het
Cry2 A T 2: 92,413,640 V396D possibly damaging Het
Cxxc5 A G 18: 35,859,265 M240V possibly damaging Het
Defa28 G A 8: 21,583,785 C68Y probably damaging Het
Dgcr14 C T 16: 17,907,780 W183* probably null Het
Ecd A G 14: 20,338,159 I187T probably damaging Het
Erg28 A G 12: 85,816,188 S117P probably benign Het
Ergic2 A T 6: 148,183,079 C319S probably damaging Het
Evc2 A C 5: 37,392,079 D773A probably damaging Het
Fam151b T A 13: 92,450,170 T252S probably benign Het
Fbxo28 A T 1: 182,317,824 M233K probably benign Het
Fbxw26 T G 9: 109,722,164 D355A probably benign Het
Gm13101 A T 4: 143,966,665 V81E probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Hk2 C T 6: 82,749,283 R94Q probably benign Het
Hps4 G A 5: 112,369,556 probably null Het
Hspg2 T A 4: 137,565,490 D4126E probably damaging Het
Kif13a T C 13: 46,929,219 E48G possibly damaging Het
Krt31 T A 11: 100,047,808 N320Y probably damaging Het
Lca5 T C 9: 83,395,608 Y561C probably damaging Het
Lrrk1 G A 7: 66,279,300 L1195F probably damaging Het
Ly6g6d A C 17: 35,074,293 Y25* probably null Het
Map3k13 T G 16: 21,911,086 M489R probably damaging Het
Mcm6 C T 1: 128,335,810 R658H probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mitf A G 6: 97,941,276 T94A probably benign Het
Mpo T A 11: 87,801,280 L513* probably null Het
Mst1r T A 9: 107,913,462 N722K probably damaging Het
Mthfd1l T A 10: 4,032,284 L497* probably null Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Naip2 C T 13: 100,154,887 R1181K probably benign Het
Nbas T C 12: 13,390,972 M1101T possibly damaging Het
Olfr10 T C 11: 49,317,857 F104L probably benign Het
Olfr1313 A T 2: 112,072,394 L63Q probably damaging Het
Olfr19 T A 16: 16,673,577 I135F probably damaging Het
Olfr290 T A 7: 84,916,253 V158D possibly damaging Het
Olfr685 A T 7: 105,180,547 Y270* probably null Het
Olfr820 T C 10: 130,017,570 S70P probably damaging Het
Olfr835 T C 9: 19,035,978 L285S probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Oxct2b A G 4: 123,117,145 D286G probably benign Het
Pax5 A T 4: 44,691,859 V129E probably damaging Het
Pax7 G A 4: 139,784,626 R215C probably damaging Het
Pcdh7 A T 5: 57,720,875 I591F probably damaging Het
Pcdhb22 T C 18: 37,519,304 V275A probably damaging Het
Pkp3 C T 7: 141,084,056 probably null Het
Plekhb1 A G 7: 100,655,392 L35P probably damaging Het
Pole T A 5: 110,332,542 F1993Y probably damaging Het
Prdx1 T C 4: 116,699,254 *200R probably null Het
Prkdc C A 16: 15,725,436 T1777N probably benign Het
Ptpn14 G A 1: 189,798,653 V106M probably damaging Het
Ptpn23 T C 9: 110,393,800 E63G possibly damaging Het
Qser1 A C 2: 104,790,099 S123A probably benign Het
Rbm11 A G 16: 75,600,787 N202D possibly damaging Het
Robo3 T A 9: 37,428,055 Y212F probably damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Serpinb1c T A 13: 32,884,252 D179V probably benign Het
Skint6 T C 4: 112,846,696 D994G possibly damaging Het
Sorbs1 A G 19: 40,393,460 S46P probably damaging Het
St8sia4 T C 1: 95,591,708 T352A possibly damaging Het
Stab1 C A 14: 31,141,330 R2133L probably benign Het
Stk11ip T C 1: 75,532,416 C730R probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex33 T A 15: 78,378,752 D234V probably damaging Het
Tle4 A T 19: 14,544,786 probably null Het
Tmem200a T A 10: 25,994,072 N100Y probably damaging Het
Tnnt2 A T 1: 135,840,859 probably null Het
Ttn T A 2: 76,875,958 probably benign Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Urgcp T C 11: 5,716,910 E476G probably benign Het
Vmn1r201 G A 13: 22,475,255 R213H probably benign Het
Vmn2r84 C T 10: 130,386,069 V761M possibly damaging Het
Vwde A T 6: 13,187,455 Y678N probably damaging Het
Wnk2 C A 13: 49,052,724 E1865* probably null Het
Zc3h3 A C 15: 75,756,931 M838R possibly damaging Het
Zfp959 T A 17: 55,897,604 C211S probably damaging Het
Other mutations in Cog6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Cog6 APN 3 52986425 missense probably benign 0.03
IGL01946:Cog6 APN 3 53002404 intron probably benign
IGL02122:Cog6 APN 3 52998342 missense probably benign 0.04
IGL02589:Cog6 APN 3 53007270 missense probably damaging 1.00
IGL02819:Cog6 APN 3 53009545 missense probably damaging 0.98
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0086:Cog6 UTSW 3 52993570 missense probably damaging 0.98
R0545:Cog6 UTSW 3 52996075 missense probably damaging 1.00
R0707:Cog6 UTSW 3 53013862 missense possibly damaging 0.71
R0718:Cog6 UTSW 3 53010629 missense probably benign 0.35
R1169:Cog6 UTSW 3 53013844 missense probably benign 0.30
R1451:Cog6 UTSW 3 53009113 missense possibly damaging 0.78
R2249:Cog6 UTSW 3 53000479 critical splice donor site probably null
R2264:Cog6 UTSW 3 52992911 nonsense probably null
R3745:Cog6 UTSW 3 52992819 missense probably benign 0.05
R4027:Cog6 UTSW 3 53002529 missense possibly damaging 0.95
R4230:Cog6 UTSW 3 52992808 missense probably benign 0.13
R4400:Cog6 UTSW 3 53012941 missense probably benign 0.11
R4551:Cog6 UTSW 3 52998320 missense probably damaging 1.00
R4866:Cog6 UTSW 3 53010598 missense probably benign 0.10
R5326:Cog6 UTSW 3 53013816 missense probably null 0.12
R6169:Cog6 UTSW 3 53007301 missense probably benign 0.03
R6273:Cog6 UTSW 3 52996052 missense probably damaging 1.00
R7169:Cog6 UTSW 3 52989966 missense possibly damaging 0.94
R7199:Cog6 UTSW 3 52983189 missense probably benign 0.21
R7243:Cog6 UTSW 3 53002315 missense probably damaging 1.00
R7299:Cog6 UTSW 3 53002507 missense probably benign 0.01
Z1177:Cog6 UTSW 3 53013864 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCTTGGTGTCATTGCCAG -3'
(R):5'- TGTTCCTCATGGCCAAGCAC -3'

Sequencing Primer
(F):5'- TGCCAGGCAGCAATTATCTG -3'
(R):5'- TGGGTAAAATGCAGCCCCTG -3'
Posted On2014-06-30