Mutagenetix > Incidental Mutation

Incidental Mutation 'R1891:Skint6'

211465

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

039911-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R1891 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 112846696 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 994 (D994G)

Ref Sequence

ENSEMBL: ENSMUSP00000132312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138966
AA Change: D994G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: D994G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171224
AA Change: D994G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: D994G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,926,033	M135K	possibly damaging	Het
Abca7	T	C	10: 80,005,040	I921T	possibly damaging	Het
Abca8a	T	C	11: 110,091,607	K3R	probably benign	Het
Adgrl3	A	T	5: 81,512,044	D152V	probably damaging	Het
Akap6	A	T	12: 53,142,175	D2124V	possibly damaging	Het
Akt1	A	G	12: 112,659,575	F88L	probably damaging	Het
Ankrd24	T	C	10: 81,643,508		probably benign	Het
Arid4b	T	A	13: 14,136,236	N141K	possibly damaging	Het
Cacna1c	C	A	6: 118,776,519	D219Y	probably damaging	Het
Ccdc113	A	G	8: 95,540,916	K170E	probably damaging	Het
Ccdc151	G	T	9: 21,995,381		probably null	Het
Ceacam9	A	G	7: 16,723,955	E136G	probably damaging	Het
Cfap43	A	G	19: 47,813,941	L333P	probably damaging	Het
Chl1	A	G	6: 103,714,583	D1062G	possibly damaging	Het
Ckb	TCCACCACCA	TCCACCA	12: 111,669,645		probably benign	Het
Clpp	T	A	17: 56,991,307	V91E	probably damaging	Het
Cndp1	A	T	18: 84,619,633	H325Q	probably null	Het
Cngb3	A	G	4: 19,366,446	N169S	probably benign	Het
Cog6	A	C	3: 52,983,180	I613R	probably benign	Het
Creb3l1	A	G	2: 91,987,040	L376P	probably damaging	Het
Cry2	A	T	2: 92,413,640	V396D	possibly damaging	Het
Cxxc5	A	G	18: 35,859,265	M240V	possibly damaging	Het
Defa28	G	A	8: 21,583,785	C68Y	probably damaging	Het
Dgcr14	C	T	16: 17,907,780	W183*	probably null	Het
Ecd	A	G	14: 20,338,159	I187T	probably damaging	Het
Erg28	A	G	12: 85,816,188	S117P	probably benign	Het
Ergic2	A	T	6: 148,183,079	C319S	probably damaging	Het
Evc2	A	C	5: 37,392,079	D773A	probably damaging	Het
Fam151b	T	A	13: 92,450,170	T252S	probably benign	Het
Fbxo28	A	T	1: 182,317,824	M233K	probably benign	Het
Fbxw26	T	G	9: 109,722,164	D355A	probably benign	Het
Gm13101	A	T	4: 143,966,665	V81E	probably damaging	Het
Gm4884	G	C	7: 41,043,115	E169D	possibly damaging	Het
Hk2	C	T	6: 82,749,283	R94Q	probably benign	Het
Hps4	G	A	5: 112,369,556		probably null	Het
Hspg2	T	A	4: 137,565,490	D4126E	probably damaging	Het
Kif13a	T	C	13: 46,929,219	E48G	possibly damaging	Het
Krt31	T	A	11: 100,047,808	N320Y	probably damaging	Het
Lca5	T	C	9: 83,395,608	Y561C	probably damaging	Het
Lrrk1	G	A	7: 66,279,300	L1195F	probably damaging	Het
Ly6g6d	A	C	17: 35,074,293	Y25*	probably null	Het
Map3k13	T	G	16: 21,911,086	M489R	probably damaging	Het
Mcm6	C	T	1: 128,335,810	R658H	probably damaging	Het
Mecp2	C	T	X: 74,037,175	A79T	probably damaging	Het
Mitf	A	G	6: 97,941,276	T94A	probably benign	Het
Mpo	T	A	11: 87,801,280	L513*	probably null	Het
Mst1r	T	A	9: 107,913,462	N722K	probably damaging	Het
Mthfd1l	T	A	10: 4,032,284	L497*	probably null	Het
Mtus1	C	T	8: 41,084,325	S118N	probably damaging	Het
Mybbp1a	C	T	11: 72,446,037	T565I	probably benign	Het
Naip2	C	T	13: 100,154,887	R1181K	probably benign	Het
Nbas	T	C	12: 13,390,972	M1101T	possibly damaging	Het
Olfr10	T	C	11: 49,317,857	F104L	probably benign	Het
Olfr1313	A	T	2: 112,072,394	L63Q	probably damaging	Het
Olfr19	T	A	16: 16,673,577	I135F	probably damaging	Het
Olfr290	T	A	7: 84,916,253	V158D	possibly damaging	Het
Olfr685	A	T	7: 105,180,547	Y270*	probably null	Het
Olfr820	T	C	10: 130,017,570	S70P	probably damaging	Het
Olfr835	T	C	9: 19,035,978	L285S	probably damaging	Het
Olfr875	T	A	9: 37,772,867	D69E	possibly damaging	Het
Oxct2b	A	G	4: 123,117,145	D286G	probably benign	Het
Pax5	A	T	4: 44,691,859	V129E	probably damaging	Het
Pax7	G	A	4: 139,784,626	R215C	probably damaging	Het
Pcdh7	A	T	5: 57,720,875	I591F	probably damaging	Het
Pcdhb22	T	C	18: 37,519,304	V275A	probably damaging	Het
Pkp3	C	T	7: 141,084,056		probably null	Het
Plekhb1	A	G	7: 100,655,392	L35P	probably damaging	Het
Pole	T	A	5: 110,332,542	F1993Y	probably damaging	Het
Prdx1	T	C	4: 116,699,254	*200R	probably null	Het
Prkdc	C	A	16: 15,725,436	T1777N	probably benign	Het
Ptpn14	G	A	1: 189,798,653	V106M	probably damaging	Het
Ptpn23	T	C	9: 110,393,800	E63G	possibly damaging	Het
Qser1	A	C	2: 104,790,099	S123A	probably benign	Het
Rbm11	A	G	16: 75,600,787	N202D	possibly damaging	Het
Robo3	T	A	9: 37,428,055	Y212F	probably damaging	Het
Sde2	G	A	1: 180,860,008	S153N	probably benign	Het
Serpinb1c	T	A	13: 32,884,252	D179V	probably benign	Het
Sorbs1	A	G	19: 40,393,460	S46P	probably damaging	Het
St8sia4	T	C	1: 95,591,708	T352A	possibly damaging	Het
Stab1	C	A	14: 31,141,330	R2133L	probably benign	Het
Stk11ip	T	C	1: 75,532,416	C730R	probably benign	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tex33	T	A	15: 78,378,752	D234V	probably damaging	Het
Tle4	A	T	19: 14,544,786		probably null	Het
Tmem200a	T	A	10: 25,994,072	N100Y	probably damaging	Het
Tnnt2	A	T	1: 135,840,859		probably null	Het
Ttn	T	A	2: 76,875,958		probably benign	Het
Ubac1	A	G	2: 26,014,962	V88A	probably benign	Het
Urgcp	T	C	11: 5,716,910	E476G	probably benign	Het
Vmn1r201	G	A	13: 22,475,255	R213H	probably benign	Het
Vmn2r84	C	T	10: 130,386,069	V761M	possibly damaging	Het
Vwde	A	T	6: 13,187,455	Y678N	probably damaging	Het
Wnk2	C	A	13: 49,052,724	E1865*	probably null	Het
Zc3h3	A	C	15: 75,756,931	M838R	possibly damaging	Het
Zfp959	T	A	17: 55,897,604	C211S	probably damaging	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGCTGTTTCTCCTGGATTAGT -3'
(R):5'- TTCTAAGGGCAATGATTGTCATAAGTA -3'

Sequencing Primer
(F):5'- CTCCTGGATTAGTTTTTCCTGAGAGC -3'
(R):5'- AGGTACAGCAGGACATTTCC -3'

Posted On

2014-06-30