Incidental Mutation 'R1891:Nbas'
ID211522
Institutional Source Beutler Lab
Gene Symbol Nbas
Ensembl Gene ENSMUSG00000020576
Gene Nameneuroblastoma amplified sequence
Synonyms4933425L03Rik
MMRRC Submission 039911-MU
Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1891 (G1)
Quality Score182
Status Not validated
Chromosome12
Chromosomal Location13269133-13583811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13390972 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1101 (M1101T)
Ref Sequence ENSEMBL: ENSMUSP00000036082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042953]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042953
AA Change: M1101T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: M1101T

DomainStartEndE-ValueType
Pfam:Nbas_N 89 370 4.7e-171 PFAM
low complexity region 463 475 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
Pfam:Sec39 725 1375 3.8e-34 PFAM
low complexity region 1392 1404 N/A INTRINSIC
low complexity region 1549 1566 N/A INTRINSIC
low complexity region 2226 2252 N/A INTRINSIC
low complexity region 2275 2285 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,033 M135K possibly damaging Het
Abca7 T C 10: 80,005,040 I921T possibly damaging Het
Abca8a T C 11: 110,091,607 K3R probably benign Het
Adgrl3 A T 5: 81,512,044 D152V probably damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Akt1 A G 12: 112,659,575 F88L probably damaging Het
Ankrd24 T C 10: 81,643,508 probably benign Het
Arid4b T A 13: 14,136,236 N141K possibly damaging Het
Cacna1c C A 6: 118,776,519 D219Y probably damaging Het
Ccdc113 A G 8: 95,540,916 K170E probably damaging Het
Ccdc151 G T 9: 21,995,381 probably null Het
Ceacam9 A G 7: 16,723,955 E136G probably damaging Het
Cfap43 A G 19: 47,813,941 L333P probably damaging Het
Chl1 A G 6: 103,714,583 D1062G possibly damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clpp T A 17: 56,991,307 V91E probably damaging Het
Cndp1 A T 18: 84,619,633 H325Q probably null Het
Cngb3 A G 4: 19,366,446 N169S probably benign Het
Cog6 A C 3: 52,983,180 I613R probably benign Het
Creb3l1 A G 2: 91,987,040 L376P probably damaging Het
Cry2 A T 2: 92,413,640 V396D possibly damaging Het
Cxxc5 A G 18: 35,859,265 M240V possibly damaging Het
Defa28 G A 8: 21,583,785 C68Y probably damaging Het
Dgcr14 C T 16: 17,907,780 W183* probably null Het
Ecd A G 14: 20,338,159 I187T probably damaging Het
Erg28 A G 12: 85,816,188 S117P probably benign Het
Ergic2 A T 6: 148,183,079 C319S probably damaging Het
Evc2 A C 5: 37,392,079 D773A probably damaging Het
Fam151b T A 13: 92,450,170 T252S probably benign Het
Fbxo28 A T 1: 182,317,824 M233K probably benign Het
Fbxw26 T G 9: 109,722,164 D355A probably benign Het
Gm13101 A T 4: 143,966,665 V81E probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Hk2 C T 6: 82,749,283 R94Q probably benign Het
Hps4 G A 5: 112,369,556 probably null Het
Hspg2 T A 4: 137,565,490 D4126E probably damaging Het
Kif13a T C 13: 46,929,219 E48G possibly damaging Het
Krt31 T A 11: 100,047,808 N320Y probably damaging Het
Lca5 T C 9: 83,395,608 Y561C probably damaging Het
Lrrk1 G A 7: 66,279,300 L1195F probably damaging Het
Ly6g6d A C 17: 35,074,293 Y25* probably null Het
Map3k13 T G 16: 21,911,086 M489R probably damaging Het
Mcm6 C T 1: 128,335,810 R658H probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mitf A G 6: 97,941,276 T94A probably benign Het
Mpo T A 11: 87,801,280 L513* probably null Het
Mst1r T A 9: 107,913,462 N722K probably damaging Het
Mthfd1l T A 10: 4,032,284 L497* probably null Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Naip2 C T 13: 100,154,887 R1181K probably benign Het
Olfr10 T C 11: 49,317,857 F104L probably benign Het
Olfr1313 A T 2: 112,072,394 L63Q probably damaging Het
Olfr19 T A 16: 16,673,577 I135F probably damaging Het
Olfr290 T A 7: 84,916,253 V158D possibly damaging Het
Olfr685 A T 7: 105,180,547 Y270* probably null Het
Olfr820 T C 10: 130,017,570 S70P probably damaging Het
Olfr835 T C 9: 19,035,978 L285S probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Oxct2b A G 4: 123,117,145 D286G probably benign Het
Pax5 A T 4: 44,691,859 V129E probably damaging Het
Pax7 G A 4: 139,784,626 R215C probably damaging Het
Pcdh7 A T 5: 57,720,875 I591F probably damaging Het
Pcdhb22 T C 18: 37,519,304 V275A probably damaging Het
Pkp3 C T 7: 141,084,056 probably null Het
Plekhb1 A G 7: 100,655,392 L35P probably damaging Het
Pole T A 5: 110,332,542 F1993Y probably damaging Het
Prdx1 T C 4: 116,699,254 *200R probably null Het
Prkdc C A 16: 15,725,436 T1777N probably benign Het
Ptpn14 G A 1: 189,798,653 V106M probably damaging Het
Ptpn23 T C 9: 110,393,800 E63G possibly damaging Het
Qser1 A C 2: 104,790,099 S123A probably benign Het
Rbm11 A G 16: 75,600,787 N202D possibly damaging Het
Robo3 T A 9: 37,428,055 Y212F probably damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Serpinb1c T A 13: 32,884,252 D179V probably benign Het
Skint6 T C 4: 112,846,696 D994G possibly damaging Het
Sorbs1 A G 19: 40,393,460 S46P probably damaging Het
St8sia4 T C 1: 95,591,708 T352A possibly damaging Het
Stab1 C A 14: 31,141,330 R2133L probably benign Het
Stk11ip T C 1: 75,532,416 C730R probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex33 T A 15: 78,378,752 D234V probably damaging Het
Tle4 A T 19: 14,544,786 probably null Het
Tmem200a T A 10: 25,994,072 N100Y probably damaging Het
Tnnt2 A T 1: 135,840,859 probably null Het
Ttn T A 2: 76,875,958 probably benign Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Urgcp T C 11: 5,716,910 E476G probably benign Het
Vmn1r201 G A 13: 22,475,255 R213H probably benign Het
Vmn2r84 C T 10: 130,386,069 V761M possibly damaging Het
Vwde A T 6: 13,187,455 Y678N probably damaging Het
Wnk2 C A 13: 49,052,724 E1865* probably null Het
Zc3h3 A C 15: 75,756,931 M838R possibly damaging Het
Zfp959 T A 17: 55,897,604 C211S probably damaging Het
Other mutations in Nbas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Nbas APN 12 13453075 missense probably benign 0.19
IGL00712:Nbas APN 12 13362625 splice site probably benign
IGL00808:Nbas APN 12 13566120 splice site probably benign
IGL00915:Nbas APN 12 13374752 nonsense probably null
IGL00923:Nbas APN 12 13336284 missense possibly damaging 0.46
IGL01152:Nbas APN 12 13360958 missense probably damaging 1.00
IGL01633:Nbas APN 12 13483897 missense probably damaging 1.00
IGL01672:Nbas APN 12 13379649 missense possibly damaging 0.63
IGL01799:Nbas APN 12 13324400 splice site probably benign
IGL01812:Nbas APN 12 13453503 missense probably damaging 1.00
IGL01934:Nbas APN 12 13289879 splice site probably benign
IGL02093:Nbas APN 12 13560962 missense probably benign 0.00
IGL02115:Nbas APN 12 13317692 splice site probably benign
IGL02175:Nbas APN 12 13566259 critical splice donor site probably null
IGL02268:Nbas APN 12 13405397 missense possibly damaging 0.94
IGL02483:Nbas APN 12 13324294 missense probably damaging 1.00
IGL02539:Nbas APN 12 13272703 splice site probably benign
IGL02557:Nbas APN 12 13361028 missense probably damaging 1.00
IGL02815:Nbas APN 12 13310266 missense probably damaging 1.00
IGL02951:Nbas APN 12 13362541 missense probably benign
IGL03131:Nbas APN 12 13279416 missense probably benign 0.03
IGL03214:Nbas APN 12 13331110 splice site probably benign
IGL03308:Nbas APN 12 13324348 missense possibly damaging 0.93
IGL03368:Nbas APN 12 13328451 missense probably benign 0.08
IGL03372:Nbas APN 12 13534472 missense probably damaging 1.00
IGL03391:Nbas APN 12 13483749 missense probably benign 0.28
medvedev UTSW 12 13534577 critical splice donor site probably null
oligarchs UTSW 12 13520750 missense possibly damaging 0.75
putin UTSW 12 13321755 missense probably damaging 1.00
1mM(1):Nbas UTSW 12 13288728 missense probably damaging 1.00
R0057:Nbas UTSW 12 13390957 missense probably benign 0.00
R0076:Nbas UTSW 12 13324336 missense probably damaging 1.00
R0153:Nbas UTSW 12 13273876 splice site probably benign
R0371:Nbas UTSW 12 13331095 missense probably damaging 0.97
R0449:Nbas UTSW 12 13519108 missense probably benign 0.18
R0791:Nbas UTSW 12 13482633 missense probably benign 0.28
R0931:Nbas UTSW 12 13331114 splice site probably benign
R1236:Nbas UTSW 12 13269241 missense probably damaging 1.00
R1371:Nbas UTSW 12 13482378 splice site probably benign
R1567:Nbas UTSW 12 13285278 missense possibly damaging 0.70
R1587:Nbas UTSW 12 13558685 missense probably benign
R1719:Nbas UTSW 12 13560977 critical splice donor site probably null
R1747:Nbas UTSW 12 13335898 missense probably benign 0.00
R1777:Nbas UTSW 12 13513562 missense probably benign 0.16
R1848:Nbas UTSW 12 13413597 missense probably damaging 0.97
R1856:Nbas UTSW 12 13474229 missense possibly damaging 0.56
R1911:Nbas UTSW 12 13566144 missense probably benign
R1912:Nbas UTSW 12 13566144 missense probably benign
R2006:Nbas UTSW 12 13414741 intron probably null
R2054:Nbas UTSW 12 13474206 missense probably benign 0.36
R2065:Nbas UTSW 12 13566157 missense probably damaging 1.00
R2089:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2091:Nbas UTSW 12 13361045 missense probably benign 0.03
R2156:Nbas UTSW 12 13441509 missense probably damaging 1.00
R2164:Nbas UTSW 12 13330646 missense possibly damaging 0.74
R2339:Nbas UTSW 12 13362592 missense probably benign 0.12
R2398:Nbas UTSW 12 13432945 missense probably damaging 0.99
R3806:Nbas UTSW 12 13482504 missense probably damaging 1.00
R3855:Nbas UTSW 12 13279414 missense possibly damaging 0.50
R4019:Nbas UTSW 12 13482519 missense probably damaging 1.00
R4083:Nbas UTSW 12 13474191 missense probably damaging 0.96
R4201:Nbas UTSW 12 13374826 missense probably benign 0.00
R4231:Nbas UTSW 12 13393343 missense probably damaging 0.98
R4552:Nbas UTSW 12 13335937 critical splice donor site probably null
R4560:Nbas UTSW 12 13583527 missense probably benign 0.00
R4728:Nbas UTSW 12 13288739 missense probably damaging 0.98
R4752:Nbas UTSW 12 13482537 missense possibly damaging 0.92
R4832:Nbas UTSW 12 13483739 missense probably benign 0.00
R4874:Nbas UTSW 12 13321755 missense probably damaging 1.00
R4988:Nbas UTSW 12 13408265 missense probably benign 0.45
R5020:Nbas UTSW 12 13374712 missense probably damaging 0.99
R5079:Nbas UTSW 12 13374711 missense probably damaging 1.00
R5129:Nbas UTSW 12 13390960 missense probably damaging 1.00
R5239:Nbas UTSW 12 13441518 missense probably benign 0.31
R5299:Nbas UTSW 12 13441925 nonsense probably null
R5351:Nbas UTSW 12 13560849 missense probably damaging 1.00
R5389:Nbas UTSW 12 13534577 critical splice donor site probably null
R5436:Nbas UTSW 12 13374811 missense probably damaging 1.00
R5654:Nbas UTSW 12 13583475 missense probably damaging 1.00
R5690:Nbas UTSW 12 13336284 missense probably damaging 1.00
R5842:Nbas UTSW 12 13269266 critical splice donor site probably null
R5959:Nbas UTSW 12 13288801 missense probably damaging 0.99
R5982:Nbas UTSW 12 13393430 missense probably benign 0.00
R6238:Nbas UTSW 12 13482595 missense probably benign
R6270:Nbas UTSW 12 13324293 missense probably damaging 1.00
R6363:Nbas UTSW 12 13482576 missense probably benign
R6424:Nbas UTSW 12 13415733 critical splice donor site probably null
R6458:Nbas UTSW 12 13288749 missense probably damaging 1.00
R6526:Nbas UTSW 12 13405425 missense probably damaging 1.00
R6654:Nbas UTSW 12 13483874 nonsense probably null
R7085:Nbas UTSW 12 13285258 missense probably damaging 1.00
R7179:Nbas UTSW 12 13405397 missense possibly damaging 0.94
R7197:Nbas UTSW 12 13520750 missense possibly damaging 0.75
R7378:Nbas UTSW 12 13274219 missense probably damaging 1.00
R7393:Nbas UTSW 12 13393492 missense probably damaging 1.00
R7425:Nbas UTSW 12 13469880 missense probably damaging 1.00
R7446:Nbas UTSW 12 13393498 missense probably benign 0.02
R7481:Nbas UTSW 12 13356959 missense probably damaging 0.97
R7535:Nbas UTSW 12 13279389 missense probably damaging 0.97
R7626:Nbas UTSW 12 13558660 missense probably benign 0.00
R7678:Nbas UTSW 12 13415661 missense probably damaging 0.97
R7912:Nbas UTSW 12 13405457 missense possibly damaging 0.91
R8193:Nbas UTSW 12 13433009 missense probably damaging 1.00
RF013:Nbas UTSW 12 13279408 missense possibly damaging 0.54
T0722:Nbas UTSW 12 13352808 missense probably benign 0.00
Z1176:Nbas UTSW 12 13483876 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGAATTTGAAACTCTTGCCTGTC -3'
(R):5'- GAAGGCAGCTGTTAATCACACTG -3'

Sequencing Primer
(F):5'- CCTCAACATAGGAATTCTGTTTACC -3'
(R):5'- CAGCTGTTAATCACACTGCATAC -3'
Posted On2014-06-30