Mutagenetix > Incidental Mutations

Incidental Mutation 'R1891:Akap6'

211523

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

039911-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.658) question?

Stock #

R1891 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53142175 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 2124 (D2124V)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095737
AA Change: D2124V

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: D2124V

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219786

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,926,033	M135K	possibly damaging	Het
Abca7	T	C	10: 80,005,040	I921T	possibly damaging	Het
Abca8a	T	C	11: 110,091,607	K3R	probably benign	Het
Adgrl3	A	T	5: 81,512,044	D152V	probably damaging	Het
Akt1	A	G	12: 112,659,575	F88L	probably damaging	Het
Ankrd24	T	C	10: 81,643,508		probably benign	Het
Arid4b	T	A	13: 14,136,236	N141K	possibly damaging	Het
Cacna1c	C	A	6: 118,776,519	D219Y	probably damaging	Het
Ccdc113	A	G	8: 95,540,916	K170E	probably damaging	Het
Ccdc151	G	T	9: 21,995,381		probably null	Het
Ceacam9	A	G	7: 16,723,955	E136G	probably damaging	Het
Cfap43	A	G	19: 47,813,941	L333P	probably damaging	Het
Chl1	A	G	6: 103,714,583	D1062G	possibly damaging	Het
Ckb	TCCACCACCA	TCCACCA	12: 111,669,645		probably benign	Het
Clpp	T	A	17: 56,991,307	V91E	probably damaging	Het
Cndp1	A	T	18: 84,619,633	H325Q	probably null	Het
Cngb3	A	G	4: 19,366,446	N169S	probably benign	Het
Cog6	A	C	3: 52,983,180	I613R	probably benign	Het
Creb3l1	A	G	2: 91,987,040	L376P	probably damaging	Het
Cry2	A	T	2: 92,413,640	V396D	possibly damaging	Het
Cxxc5	A	G	18: 35,859,265	M240V	possibly damaging	Het
Defa28	G	A	8: 21,583,785	C68Y	probably damaging	Het
Dgcr14	C	T	16: 17,907,780	W183*	probably null	Het
Ecd	A	G	14: 20,338,159	I187T	probably damaging	Het
Erg28	A	G	12: 85,816,188	S117P	probably benign	Het
Ergic2	A	T	6: 148,183,079	C319S	probably damaging	Het
Evc2	A	C	5: 37,392,079	D773A	probably damaging	Het
Fam151b	T	A	13: 92,450,170	T252S	probably benign	Het
Fbxo28	A	T	1: 182,317,824	M233K	probably benign	Het
Fbxw26	T	G	9: 109,722,164	D355A	probably benign	Het
Gm13101	A	T	4: 143,966,665	V81E	probably damaging	Het
Gm4884	G	C	7: 41,043,115	E169D	possibly damaging	Het
Hk2	C	T	6: 82,749,283	R94Q	probably benign	Het
Hps4	G	A	5: 112,369,556		probably null	Het
Hspg2	T	A	4: 137,565,490	D4126E	probably damaging	Het
Kif13a	T	C	13: 46,929,219	E48G	possibly damaging	Het
Krt31	T	A	11: 100,047,808	N320Y	probably damaging	Het
Lca5	T	C	9: 83,395,608	Y561C	probably damaging	Het
Lrrk1	G	A	7: 66,279,300	L1195F	probably damaging	Het
Ly6g6d	A	C	17: 35,074,293	Y25*	probably null	Het
Map3k13	T	G	16: 21,911,086	M489R	probably damaging	Het
Mcm6	C	T	1: 128,335,810	R658H	probably damaging	Het
Mecp2	C	T	X: 74,037,175	A79T	probably damaging	Het
Mitf	A	G	6: 97,941,276	T94A	probably benign	Het
Mpo	T	A	11: 87,801,280	L513*	probably null	Het
Mst1r	T	A	9: 107,913,462	N722K	probably damaging	Het
Mthfd1l	T	A	10: 4,032,284	L497*	probably null	Het
Mtus1	C	T	8: 41,084,325	S118N	probably damaging	Het
Mybbp1a	C	T	11: 72,446,037	T565I	probably benign	Het
Naip2	C	T	13: 100,154,887	R1181K	probably benign	Het
Nbas	T	C	12: 13,390,972	M1101T	possibly damaging	Het
Olfr10	T	C	11: 49,317,857	F104L	probably benign	Het
Olfr1313	A	T	2: 112,072,394	L63Q	probably damaging	Het
Olfr19	T	A	16: 16,673,577	I135F	probably damaging	Het
Olfr290	T	A	7: 84,916,253	V158D	possibly damaging	Het
Olfr685	A	T	7: 105,180,547	Y270*	probably null	Het
Olfr820	T	C	10: 130,017,570	S70P	probably damaging	Het
Olfr835	T	C	9: 19,035,978	L285S	probably damaging	Het
Olfr875	T	A	9: 37,772,867	D69E	possibly damaging	Het
Oxct2b	A	G	4: 123,117,145	D286G	probably benign	Het
Pax5	A	T	4: 44,691,859	V129E	probably damaging	Het
Pax7	G	A	4: 139,784,626	R215C	probably damaging	Het
Pcdh7	A	T	5: 57,720,875	I591F	probably damaging	Het
Pcdhb22	T	C	18: 37,519,304	V275A	probably damaging	Het
Pkp3	C	T	7: 141,084,056		probably null	Het
Plekhb1	A	G	7: 100,655,392	L35P	probably damaging	Het
Pole	T	A	5: 110,332,542	F1993Y	probably damaging	Het
Prdx1	T	C	4: 116,699,254	*200R	probably null	Het
Prkdc	C	A	16: 15,725,436	T1777N	probably benign	Het
Ptpn14	G	A	1: 189,798,653	V106M	probably damaging	Het
Ptpn23	T	C	9: 110,393,800	E63G	possibly damaging	Het
Qser1	A	C	2: 104,790,099	S123A	probably benign	Het
Rbm11	A	G	16: 75,600,787	N202D	possibly damaging	Het
Robo3	T	A	9: 37,428,055	Y212F	probably damaging	Het
Sde2	G	A	1: 180,860,008	S153N	probably benign	Het
Serpinb1c	T	A	13: 32,884,252	D179V	probably benign	Het
Skint6	T	C	4: 112,846,696	D994G	possibly damaging	Het
Sorbs1	A	G	19: 40,393,460	S46P	probably damaging	Het
St8sia4	T	C	1: 95,591,708	T352A	possibly damaging	Het
Stab1	C	A	14: 31,141,330	R2133L	probably benign	Het
Stk11ip	T	C	1: 75,532,416	C730R	probably benign	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tex33	T	A	15: 78,378,752	D234V	probably damaging	Het
Tle4	A	T	19: 14,544,786		probably null	Het
Tmem200a	T	A	10: 25,994,072	N100Y	probably damaging	Het
Tnnt2	A	T	1: 135,840,859		probably null	Het
Ttn	T	A	2: 76,875,958		probably benign	Het
Ubac1	A	G	2: 26,014,962	V88A	probably benign	Het
Urgcp	T	C	11: 5,716,910	E476G	probably benign	Het
Vmn1r201	G	A	13: 22,475,255	R213H	probably benign	Het
Vmn2r84	C	T	10: 130,386,069	V761M	possibly damaging	Het
Vwde	A	T	6: 13,187,455	Y678N	probably damaging	Het
Wnk2	C	A	13: 49,052,724	E1865*	probably null	Het
Zc3h3	A	C	15: 75,756,931	M838R	possibly damaging	Het
Zfp959	T	A	17: 55,897,604	C211S	probably damaging	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CATTGACATGGCATCAACAGC -3'
(R):5'- AGAAGAGCTGGCTGTCATTTG -3'

Sequencing Primer
(F):5'- TGGCATCAACAGCCCTCAAAAG -3'
(R):5'- CATTTGTTCTGGCTTAGCAGC -3'

Posted On

2014-06-30