Incidental Mutation 'R1891:Rbm11'
ID211545
Institutional Source Beutler Lab
Gene Symbol Rbm11
Ensembl Gene ENSMUSG00000032940
Gene NameRNA binding motif protein 11
Synonyms
MMRRC Submission 039911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1891 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location75592844-75602829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75600787 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 202 (N202D)
Ref Sequence ENSEMBL: ENSMUSP00000109887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046378] [ENSMUST00000114249] [ENSMUST00000114253]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046378
AA Change: N202D

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038956
Gene: ENSMUSG00000032940
AA Change: N202D

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114249
AA Change: N202D

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109887
Gene: ENSMUSG00000032940
AA Change: N202D

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114253
AA Change: N202D

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109891
Gene: ENSMUSG00000032940
AA Change: N202D

DomainStartEndE-ValueType
RRM 11 83 3.25e-23 SMART
low complexity region 210 217 N/A INTRINSIC
low complexity region 228 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,033 M135K possibly damaging Het
Abca7 T C 10: 80,005,040 I921T possibly damaging Het
Abca8a T C 11: 110,091,607 K3R probably benign Het
Adgrl3 A T 5: 81,512,044 D152V probably damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Akt1 A G 12: 112,659,575 F88L probably damaging Het
Ankrd24 T C 10: 81,643,508 probably benign Het
Arid4b T A 13: 14,136,236 N141K possibly damaging Het
Cacna1c C A 6: 118,776,519 D219Y probably damaging Het
Ccdc113 A G 8: 95,540,916 K170E probably damaging Het
Ccdc151 G T 9: 21,995,381 probably null Het
Ceacam9 A G 7: 16,723,955 E136G probably damaging Het
Cfap43 A G 19: 47,813,941 L333P probably damaging Het
Chl1 A G 6: 103,714,583 D1062G possibly damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clpp T A 17: 56,991,307 V91E probably damaging Het
Cndp1 A T 18: 84,619,633 H325Q probably null Het
Cngb3 A G 4: 19,366,446 N169S probably benign Het
Cog6 A C 3: 52,983,180 I613R probably benign Het
Creb3l1 A G 2: 91,987,040 L376P probably damaging Het
Cry2 A T 2: 92,413,640 V396D possibly damaging Het
Cxxc5 A G 18: 35,859,265 M240V possibly damaging Het
Defa28 G A 8: 21,583,785 C68Y probably damaging Het
Dgcr14 C T 16: 17,907,780 W183* probably null Het
Ecd A G 14: 20,338,159 I187T probably damaging Het
Erg28 A G 12: 85,816,188 S117P probably benign Het
Ergic2 A T 6: 148,183,079 C319S probably damaging Het
Evc2 A C 5: 37,392,079 D773A probably damaging Het
Fam151b T A 13: 92,450,170 T252S probably benign Het
Fbxo28 A T 1: 182,317,824 M233K probably benign Het
Fbxw26 T G 9: 109,722,164 D355A probably benign Het
Gm13101 A T 4: 143,966,665 V81E probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Hk2 C T 6: 82,749,283 R94Q probably benign Het
Hps4 G A 5: 112,369,556 probably null Het
Hspg2 T A 4: 137,565,490 D4126E probably damaging Het
Kif13a T C 13: 46,929,219 E48G possibly damaging Het
Krt31 T A 11: 100,047,808 N320Y probably damaging Het
Lca5 T C 9: 83,395,608 Y561C probably damaging Het
Lrrk1 G A 7: 66,279,300 L1195F probably damaging Het
Ly6g6d A C 17: 35,074,293 Y25* probably null Het
Map3k13 T G 16: 21,911,086 M489R probably damaging Het
Mcm6 C T 1: 128,335,810 R658H probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mitf A G 6: 97,941,276 T94A probably benign Het
Mpo T A 11: 87,801,280 L513* probably null Het
Mst1r T A 9: 107,913,462 N722K probably damaging Het
Mthfd1l T A 10: 4,032,284 L497* probably null Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Naip2 C T 13: 100,154,887 R1181K probably benign Het
Nbas T C 12: 13,390,972 M1101T possibly damaging Het
Olfr10 T C 11: 49,317,857 F104L probably benign Het
Olfr1313 A T 2: 112,072,394 L63Q probably damaging Het
Olfr19 T A 16: 16,673,577 I135F probably damaging Het
Olfr290 T A 7: 84,916,253 V158D possibly damaging Het
Olfr685 A T 7: 105,180,547 Y270* probably null Het
Olfr820 T C 10: 130,017,570 S70P probably damaging Het
Olfr835 T C 9: 19,035,978 L285S probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Oxct2b A G 4: 123,117,145 D286G probably benign Het
Pax5 A T 4: 44,691,859 V129E probably damaging Het
Pax7 G A 4: 139,784,626 R215C probably damaging Het
Pcdh7 A T 5: 57,720,875 I591F probably damaging Het
Pcdhb22 T C 18: 37,519,304 V275A probably damaging Het
Pkp3 C T 7: 141,084,056 probably null Het
Plekhb1 A G 7: 100,655,392 L35P probably damaging Het
Pole T A 5: 110,332,542 F1993Y probably damaging Het
Prdx1 T C 4: 116,699,254 *200R probably null Het
Prkdc C A 16: 15,725,436 T1777N probably benign Het
Ptpn14 G A 1: 189,798,653 V106M probably damaging Het
Ptpn23 T C 9: 110,393,800 E63G possibly damaging Het
Qser1 A C 2: 104,790,099 S123A probably benign Het
Robo3 T A 9: 37,428,055 Y212F probably damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Serpinb1c T A 13: 32,884,252 D179V probably benign Het
Skint6 T C 4: 112,846,696 D994G possibly damaging Het
Sorbs1 A G 19: 40,393,460 S46P probably damaging Het
St8sia4 T C 1: 95,591,708 T352A possibly damaging Het
Stab1 C A 14: 31,141,330 R2133L probably benign Het
Stk11ip T C 1: 75,532,416 C730R probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex33 T A 15: 78,378,752 D234V probably damaging Het
Tle4 A T 19: 14,544,786 probably null Het
Tmem200a T A 10: 25,994,072 N100Y probably damaging Het
Tnnt2 A T 1: 135,840,859 probably null Het
Ttn T A 2: 76,875,958 probably benign Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Urgcp T C 11: 5,716,910 E476G probably benign Het
Vmn1r201 G A 13: 22,475,255 R213H probably benign Het
Vmn2r84 C T 10: 130,386,069 V761M possibly damaging Het
Vwde A T 6: 13,187,455 Y678N probably damaging Het
Wnk2 C A 13: 49,052,724 E1865* probably null Het
Zc3h3 A C 15: 75,756,931 M838R possibly damaging Het
Zfp959 T A 17: 55,897,604 C211S probably damaging Het
Other mutations in Rbm11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Rbm11 APN 16 75600622 missense probably benign 0.01
IGL02245:Rbm11 APN 16 75593008 missense possibly damaging 0.74
IGL03350:Rbm11 APN 16 75600808 missense probably benign 0.31
R0060:Rbm11 UTSW 16 75598779 missense probably damaging 0.98
R0815:Rbm11 UTSW 16 75596637 missense probably damaging 1.00
R1351:Rbm11 UTSW 16 75596643 missense possibly damaging 0.91
R1562:Rbm11 UTSW 16 75596535 missense probably damaging 1.00
R1793:Rbm11 UTSW 16 75600797 missense probably damaging 1.00
R1965:Rbm11 UTSW 16 75598768 splice site probably null
R3757:Rbm11 UTSW 16 75596581 missense probably damaging 1.00
R3928:Rbm11 UTSW 16 75593044 critical splice donor site probably null
R4513:Rbm11 UTSW 16 75596587 missense probably damaging 1.00
R5314:Rbm11 UTSW 16 75596586 missense probably damaging 1.00
R5418:Rbm11 UTSW 16 75596535 missense probably damaging 1.00
R5530:Rbm11 UTSW 16 75592973 missense possibly damaging 0.66
R5891:Rbm11 UTSW 16 75598837 missense possibly damaging 0.55
R6293:Rbm11 UTSW 16 75596767 splice site probably null
R7853:Rbm11 UTSW 16 75593035 missense probably damaging 1.00
R8167:Rbm11 UTSW 16 75598785 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAAAGCACATGTGAGGTG -3'
(R):5'- ATGGATCATTTGGTGCAACAG -3'

Sequencing Primer
(F):5'- TTCACAGCCATGGTACGC -3'
(R):5'- GTGCAGATACAGTTCGCT -3'
Posted On2014-06-30