Mutagenetix > Incidental Mutation

Incidental Mutation 'R1892:Itgav'

211572

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

039912-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83771336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 350 (N350K)

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably damaging
Transcript: ENSMUST00000028499
AA Change: N386K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: N386K

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111740
AA Change: N350K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: N350K

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,216,338	A270T	probably benign	Het
Abcb7	A	T	X: 104,342,536	H97Q	probably damaging	Het
Adat3	T	C	10: 80,606,415	L29P	probably damaging	Het
AI987944	A	T	7: 41,374,596	C320S	probably damaging	Het
Asic4	C	T	1: 75,469,482	R285W	probably damaging	Het
Asic5	A	T	3: 82,020,986	I419L	probably damaging	Het
Batf	A	G	12: 85,689,328	K42E	probably damaging	Het
Bcar3	A	G	3: 122,508,136	N160S	probably benign	Het
Bco2	C	A	9: 50,550,563	G47V	probably damaging	Het
Bicc1	T	G	10: 70,958,784	K181T	probably damaging	Het
Brinp2	A	G	1: 158,254,972		probably null	Het
Cacng8	A	G	7: 3,415,052	D240G	possibly damaging	Het
Calca	A	G	7: 114,633,727	Y96H	probably damaging	Het
Cdh1	A	T	8: 106,664,250	K666I	possibly damaging	Het
Cdh16	A	T	8: 104,617,999	I500N	possibly damaging	Het
Chst14	A	G	2: 118,927,349	Y208C	probably damaging	Het
Chst9	T	C	18: 15,452,960	H182R	probably damaging	Het
Clk2	A	G	3: 89,175,195	I367M	possibly damaging	Het
Cobl	G	C	11: 12,253,258	S1066W	probably damaging	Het
Ctcfl	A	G	2: 173,118,685	V35A	probably benign	Het
Dchs1	G	T	7: 105,764,156	H1151N	probably benign	Het
Dennd1c	T	C	17: 57,067,083	T529A	probably benign	Het
Dnah11	A	T	12: 118,106,474	V1532D	possibly damaging	Het
Dync1h1	A	G	12: 110,646,304	Y2871C	probably damaging	Het
Dytn	T	C	1: 63,677,261	E51G	probably benign	Het
Esd	C	T	14: 74,749,673	A266V	probably damaging	Het
Fam104a	G	T	11: 113,663,386	P161H	probably damaging	Het
Gli1	T	C	10: 127,330,106	M1093V	possibly damaging	Het
Gm15446	A	G	5: 109,943,387	K502E	probably damaging	Het
Gm15448	A	C	7: 3,824,574	C195G	probably benign	Het
Gm4076	T	A	13: 85,127,328		noncoding transcript	Het
Gm9830	A	G	9: 44,464,528		noncoding transcript	Het
Gm9938	G	A	19: 23,724,591		probably benign	Het
Grhl1	G	A	12: 24,584,910	R245H	probably damaging	Het
Hnrnpul1	A	T	7: 25,726,766	D553E	probably benign	Het
Hpn	G	A	7: 31,099,043	Q415*	probably null	Het
Hsd11b1	T	G	1: 193,223,760	M175L	probably benign	Het
Htra1	G	A	7: 130,985,069	V461I	possibly damaging	Het
Il1rl2	A	G	1: 40,327,534	H76R	probably damaging	Het
Insrr	G	A	3: 87,813,877	V1112M	probably damaging	Het
Ints9	T	C	14: 65,020,423	S351P	probably benign	Het
Kdm4d	C	A	9: 14,464,317	V82L	probably benign	Het
Klc1	T	C	12: 111,781,827		probably null	Het
Kmt5c	T	A	7: 4,742,715	C69*	probably null	Het
Lgals3	T	G	14: 47,384,707	N193K	possibly damaging	Het
Morc2b	T	A	17: 33,135,774	D1008V	probably damaging	Het
Mpg	C	T	11: 32,231,720	Q243*	probably null	Het
Muc15	C	T	2: 110,737,352	R281*	probably null	Het
Ncstn	CAGCTCCACGAAG	CAG	1: 172,071,471		probably null	Het
Nek5	A	G	8: 22,107,729	M278T	probably benign	Het
Npas2	A	G	1: 39,345,422	T599A	probably benign	Het
Nrf1	A	G	6: 30,144,788	D519G	probably null	Het
Nup43	A	G	10: 7,673,609	H176R	probably damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr218	T	C	1: 173,204,228	Y291H	probably damaging	Het
Olfr497	A	T	7: 108,422,940	Y123F	possibly damaging	Het
Olfr790	A	C	10: 129,501,033	I50L	probably benign	Het
Perm1	C	T	4: 156,217,883	R295C	probably benign	Het
Pik3ip1	G	T	11: 3,333,304	A135S	probably damaging	Het
Ppp4c	A	G	7: 126,786,280	V119A	probably damaging	Het
Prepl	A	G	17: 85,088,450	Y35H	possibly damaging	Het
Ptpn13	A	G	5: 103,501,679	Y316C	possibly damaging	Het
Pxk	C	T	14: 8,151,507	R441*	probably null	Het
Ranbp2	T	C	10: 58,464,099	V491A	probably benign	Het
Ranbp9	C	A	13: 43,416,457	C495F	possibly damaging	Het
Rfx8	A	T	1: 39,670,586		probably null	Het
Rnf111	T	A	9: 70,476,374	K92N	probably damaging	Het
Rtn1	A	G	12: 72,212,563	I772T	probably damaging	Het
Ryr2	T	A	13: 11,658,958	K72*	probably null	Het
Sergef	A	T	7: 46,614,616		probably null	Het
Sez6l	T	C	5: 112,472,799	N305S	probably damaging	Het
Slc40a1	A	T	1: 45,911,142	C383*	probably null	Het
Stab2	C	T	10: 86,938,049	C806Y	probably damaging	Het
Stard9	A	G	2: 120,693,708	T795A	probably benign	Het
Stk31	T	C	6: 49,438,474	I536T	probably damaging	Het
Stox1	T	A	10: 62,665,399	T461S	possibly damaging	Het
Suv39h2	T	C	2: 3,459,768	Y219C	probably damaging	Het
Tap1	T	G	17: 34,194,941	D643E	probably damaging	Het
Tbc1d2b	T	A	9: 90,218,943	I665F	probably damaging	Het
Tdrd6	T	C	17: 43,624,805	N1784S	probably benign	Het
Tmem14c	T	C	13: 41,021,157	F81L	possibly damaging	Het
Tnrc6c	A	G	11: 117,714,362	N108D	probably benign	Het
Tox3	A	T	8: 90,270,241	N131K	probably benign	Het
Tspear	T	A	10: 77,870,474	D359E	probably benign	Het
Ttc9	A	G	12: 81,631,777	I125V	probably benign	Het
Ttn	A	T	2: 76,898,187		probably benign	Het
Ubn2	C	T	6: 38,491,291	S980F	probably damaging	Het
Zfp362	T	A	4: 128,790,264	T30S	probably benign	Het
Zfp385c	A	C	11: 100,637,804	H32Q	probably damaging	Het
Zfp870	A	T	17: 32,883,889	H156Q	possibly damaging	Het
Zfp873	T	C	10: 82,061,246	C641R	probably damaging	Het
Zfp950	A	T	19: 61,119,111	H511Q	probably benign	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGATGTGTTTATTGGAGCCCC -3'
(R):5'- AGGCTCCTTTCAGAATTCAATCATC -3'

Sequencing Primer
(F):5'- CCCTGTTCATGGACCGAGGTTC -3'
(R):5'- GCTCATGAAAGCCAAGTTTTGAC -3'

Posted On

2014-06-30