Mutagenetix > Incidental Mutation

Incidental Mutation 'R1892:Dchs1'

211598

Institutional Source

Beutler Lab

Gene Symbol

Dchs1

Ensembl Gene

ENSMUSG00000036862

Gene Name

dachsous cadherin related 1

Synonyms

3110041P15Rik, C130033F22Rik

MMRRC Submission

039912-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105752990-105787654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 105764156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 1151 (H1151N)

Ref Sequence

ENSEMBL: ENSMUSP00000077574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078482]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000078482
AA Change: H1151N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: H1151N

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
CA	58	135	5.2e-11	SMART
CA	159	247	6.1e-17	SMART
CA	271	354	2.6e-30	SMART
CA	382	464	7.8e-26	SMART
CA	489	570	1.2e-34	SMART
CA	594	677	1.9e-27	SMART
CA	701	782	5.3e-11	SMART
CA	806	886	1e-12	SMART
CA	910	990	3.3e-14	SMART
CA	1016	1097	3.6e-18	SMART
CA	1121	1203	3.1e-34	SMART
CA	1233	1307	8.8e-16	SMART
low complexity region	1323	1335	N/A	INTRINSIC
CA	1344	1427	9.9e-9	SMART
CA	1451	1537	1.5e-23	SMART
CA	1560	1640	7.2e-32	SMART
CA	1664	1742	1.8e-31	SMART
CA	1765	1846	7.8e-30	SMART
CA	1870	1951	3.7e-26	SMART
low complexity region	1957	1965	N/A	INTRINSIC
CA	1979	2059	1.1e-6	SMART
CA	2083	2162	2.7e-18	SMART
CA	2186	2268	2.2e-26	SMART
CA	2291	2367	1e-18	SMART
CA	2391	2473	1.8e-23	SMART
CA	2497	2593	3.5e-21	SMART
CA	2617	2697	1.2e-25	SMART
CA	2721	2804	1.9e-18	SMART
CA	2828	2919	3e-3	SMART
transmembrane domain	2932	2954	N/A	INTRINSIC
low complexity region	3001	3017	N/A	INTRINSIC
low complexity region	3046	3055	N/A	INTRINSIC
low complexity region	3088	3097	N/A	INTRINSIC
low complexity region	3185	3196	N/A	INTRINSIC
low complexity region	3237	3259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154659

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,216,338	A270T	probably benign	Het
Abcb7	A	T	X: 104,342,536	H97Q	probably damaging	Het
Adat3	T	C	10: 80,606,415	L29P	probably damaging	Het
AI987944	A	T	7: 41,374,596	C320S	probably damaging	Het
Asic4	C	T	1: 75,469,482	R285W	probably damaging	Het
Asic5	A	T	3: 82,020,986	I419L	probably damaging	Het
Batf	A	G	12: 85,689,328	K42E	probably damaging	Het
Bcar3	A	G	3: 122,508,136	N160S	probably benign	Het
Bco2	C	A	9: 50,550,563	G47V	probably damaging	Het
Bicc1	T	G	10: 70,958,784	K181T	probably damaging	Het
Brinp2	A	G	1: 158,254,972		probably null	Het
Cacng8	A	G	7: 3,415,052	D240G	possibly damaging	Het
Calca	A	G	7: 114,633,727	Y96H	probably damaging	Het
Cdh1	A	T	8: 106,664,250	K666I	possibly damaging	Het
Cdh16	A	T	8: 104,617,999	I500N	possibly damaging	Het
Chst14	A	G	2: 118,927,349	Y208C	probably damaging	Het
Chst9	T	C	18: 15,452,960	H182R	probably damaging	Het
Clk2	A	G	3: 89,175,195	I367M	possibly damaging	Het
Cobl	G	C	11: 12,253,258	S1066W	probably damaging	Het
Ctcfl	A	G	2: 173,118,685	V35A	probably benign	Het
Dennd1c	T	C	17: 57,067,083	T529A	probably benign	Het
Dnah11	A	T	12: 118,106,474	V1532D	possibly damaging	Het
Dync1h1	A	G	12: 110,646,304	Y2871C	probably damaging	Het
Dytn	T	C	1: 63,677,261	E51G	probably benign	Het
Esd	C	T	14: 74,749,673	A266V	probably damaging	Het
Fam104a	G	T	11: 113,663,386	P161H	probably damaging	Het
Gli1	T	C	10: 127,330,106	M1093V	possibly damaging	Het
Gm15446	A	G	5: 109,943,387	K502E	probably damaging	Het
Gm15448	A	C	7: 3,824,574	C195G	probably benign	Het
Gm4076	T	A	13: 85,127,328		noncoding transcript	Het
Gm9830	A	G	9: 44,464,528		noncoding transcript	Het
Gm9938	G	A	19: 23,724,591		probably benign	Het
Grhl1	G	A	12: 24,584,910	R245H	probably damaging	Het
Hnrnpul1	A	T	7: 25,726,766	D553E	probably benign	Het
Hpn	G	A	7: 31,099,043	Q415*	probably null	Het
Hsd11b1	T	G	1: 193,223,760	M175L	probably benign	Het
Htra1	G	A	7: 130,985,069	V461I	possibly damaging	Het
Il1rl2	A	G	1: 40,327,534	H76R	probably damaging	Het
Insrr	G	A	3: 87,813,877	V1112M	probably damaging	Het
Ints9	T	C	14: 65,020,423	S351P	probably benign	Het
Itgav	T	A	2: 83,771,336	N350K	probably damaging	Het
Kdm4d	C	A	9: 14,464,317	V82L	probably benign	Het
Klc1	T	C	12: 111,781,827		probably null	Het
Kmt5c	T	A	7: 4,742,715	C69*	probably null	Het
Lgals3	T	G	14: 47,384,707	N193K	possibly damaging	Het
Morc2b	T	A	17: 33,135,774	D1008V	probably damaging	Het
Mpg	C	T	11: 32,231,720	Q243*	probably null	Het
Muc15	C	T	2: 110,737,352	R281*	probably null	Het
Ncstn	CAGCTCCACGAAG	CAG	1: 172,071,471		probably null	Het
Nek5	A	G	8: 22,107,729	M278T	probably benign	Het
Npas2	A	G	1: 39,345,422	T599A	probably benign	Het
Nrf1	A	G	6: 30,144,788	D519G	probably null	Het
Nup43	A	G	10: 7,673,609	H176R	probably damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr218	T	C	1: 173,204,228	Y291H	probably damaging	Het
Olfr497	A	T	7: 108,422,940	Y123F	possibly damaging	Het
Olfr790	A	C	10: 129,501,033	I50L	probably benign	Het
Perm1	C	T	4: 156,217,883	R295C	probably benign	Het
Pik3ip1	G	T	11: 3,333,304	A135S	probably damaging	Het
Ppp4c	A	G	7: 126,786,280	V119A	probably damaging	Het
Prepl	A	G	17: 85,088,450	Y35H	possibly damaging	Het
Ptpn13	A	G	5: 103,501,679	Y316C	possibly damaging	Het
Pxk	C	T	14: 8,151,507	R441*	probably null	Het
Ranbp2	T	C	10: 58,464,099	V491A	probably benign	Het
Ranbp9	C	A	13: 43,416,457	C495F	possibly damaging	Het
Rfx8	A	T	1: 39,670,586		probably null	Het
Rnf111	T	A	9: 70,476,374	K92N	probably damaging	Het
Rtn1	A	G	12: 72,212,563	I772T	probably damaging	Het
Ryr2	T	A	13: 11,658,958	K72*	probably null	Het
Sergef	A	T	7: 46,614,616		probably null	Het
Sez6l	T	C	5: 112,472,799	N305S	probably damaging	Het
Slc40a1	A	T	1: 45,911,142	C383*	probably null	Het
Stab2	C	T	10: 86,938,049	C806Y	probably damaging	Het
Stard9	A	G	2: 120,693,708	T795A	probably benign	Het
Stk31	T	C	6: 49,438,474	I536T	probably damaging	Het
Stox1	T	A	10: 62,665,399	T461S	possibly damaging	Het
Suv39h2	T	C	2: 3,459,768	Y219C	probably damaging	Het
Tap1	T	G	17: 34,194,941	D643E	probably damaging	Het
Tbc1d2b	T	A	9: 90,218,943	I665F	probably damaging	Het
Tdrd6	T	C	17: 43,624,805	N1784S	probably benign	Het
Tmem14c	T	C	13: 41,021,157	F81L	possibly damaging	Het
Tnrc6c	A	G	11: 117,714,362	N108D	probably benign	Het
Tox3	A	T	8: 90,270,241	N131K	probably benign	Het
Tspear	T	A	10: 77,870,474	D359E	probably benign	Het
Ttc9	A	G	12: 81,631,777	I125V	probably benign	Het
Ttn	A	T	2: 76,898,187		probably benign	Het
Ubn2	C	T	6: 38,491,291	S980F	probably damaging	Het
Zfp362	T	A	4: 128,790,264	T30S	probably benign	Het
Zfp385c	A	C	11: 100,637,804	H32Q	probably damaging	Het
Zfp870	A	T	17: 32,883,889	H156Q	possibly damaging	Het
Zfp873	T	C	10: 82,061,246	C641R	probably damaging	Het
Zfp950	A	T	19: 61,119,111	H511Q	probably benign	Het

Other mutations in Dchs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Dchs1	APN	7	105758743	missense	probably damaging	1.00
IGL00422:Dchs1	APN	7	105758029	missense	possibly damaging	0.88
IGL00427:Dchs1	APN	7	105758424	missense	probably damaging	0.98
IGL00469:Dchs1	APN	7	105755261	missense	probably damaging	1.00
IGL00470:Dchs1	APN	7	105758207	missense	probably damaging	1.00
IGL00534:Dchs1	APN	7	105757943	missense	probably benign
IGL01292:Dchs1	APN	7	105760891	missense	probably damaging	0.98
IGL01380:Dchs1	APN	7	105762211	missense	probably damaging	1.00
IGL01396:Dchs1	APN	7	105772283	missense	probably damaging	1.00
IGL01448:Dchs1	APN	7	105771927	missense	probably damaging	0.98
IGL01759:Dchs1	APN	7	105755302	missense	probably benign	0.00
IGL01829:Dchs1	APN	7	105755397	missense	probably damaging	0.99
IGL01946:Dchs1	APN	7	105759105	missense	probably damaging	1.00
IGL01955:Dchs1	APN	7	105757591	missense	probably benign	0.00
IGL02012:Dchs1	APN	7	105764297	missense	probably damaging	0.98
IGL02222:Dchs1	APN	7	105764887	missense	probably damaging	1.00
IGL02261:Dchs1	APN	7	105772569	missense	probably damaging	1.00
IGL02365:Dchs1	APN	7	105755188	missense	probably benign	0.22
IGL02430:Dchs1	APN	7	105771971	missense	probably benign	0.34
IGL02500:Dchs1	APN	7	105755806	missense	probably benign
IGL02741:Dchs1	APN	7	105757323	missense	probably damaging	1.00
IGL02890:Dchs1	APN	7	105756491	missense	probably damaging	1.00
IGL03213:Dchs1	APN	7	105755072	missense	probably damaging	1.00
G1patch:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
P0026:Dchs1	UTSW	7	105758405	missense	probably damaging	0.99
PIT4377001:Dchs1	UTSW	7	105757588	missense	probably damaging	1.00
PIT4791001:Dchs1	UTSW	7	105758971	missense	probably damaging	1.00
R0013:Dchs1	UTSW	7	105755836	missense	possibly damaging	0.90
R0090:Dchs1	UTSW	7	105755932	missense	probably benign	0.18
R0091:Dchs1	UTSW	7	105766094	splice site	probably benign
R0193:Dchs1	UTSW	7	105764983	missense	probably benign	0.40
R0395:Dchs1	UTSW	7	105758538	missense	probably damaging	1.00
R0448:Dchs1	UTSW	7	105765927	missense	probably benign	0.00
R0480:Dchs1	UTSW	7	105771489	missense	probably benign	0.14
R0485:Dchs1	UTSW	7	105772727	missense	probably benign	0.00
R0566:Dchs1	UTSW	7	105759195	missense	probably benign	0.00
R0571:Dchs1	UTSW	7	105771996	missense	probably damaging	1.00
R0573:Dchs1	UTSW	7	105758778	missense	probably damaging	0.98
R0577:Dchs1	UTSW	7	105764255	missense	possibly damaging	0.78
R0622:Dchs1	UTSW	7	105763449	missense	probably damaging	1.00
R0654:Dchs1	UTSW	7	105772349	missense	probably damaging	1.00
R0677:Dchs1	UTSW	7	105764984	missense	probably damaging	1.00
R1171:Dchs1	UTSW	7	105757714	missense	probably benign
R1241:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R1389:Dchs1	UTSW	7	105755571	missense	probably benign	0.40
R1427:Dchs1	UTSW	7	105766191	missense	probably benign	0.06
R1458:Dchs1	UTSW	7	105755244	missense	probably damaging	1.00
R1513:Dchs1	UTSW	7	105772071	nonsense	probably null
R1524:Dchs1	UTSW	7	105764525	missense	probably damaging	1.00
R1525:Dchs1	UTSW	7	105758931	missense	probably damaging	1.00
R1534:Dchs1	UTSW	7	105772040	missense	probably damaging	0.98
R1567:Dchs1	UTSW	7	105771861	missense	probably benign	0.01
R1577:Dchs1	UTSW	7	105765955	missense	probably damaging	1.00
R1603:Dchs1	UTSW	7	105762770	missense	probably benign	0.24
R1676:Dchs1	UTSW	7	105754921	missense	probably benign	0.40
R1794:Dchs1	UTSW	7	105771720	missense	probably benign	0.02
R1826:Dchs1	UTSW	7	105757627	missense	probably damaging	1.00
R1924:Dchs1	UTSW	7	105772280	missense	possibly damaging	0.81
R1932:Dchs1	UTSW	7	105765902	missense	probably damaging	1.00
R1962:Dchs1	UTSW	7	105764201	missense	probably damaging	1.00
R1985:Dchs1	UTSW	7	105772398	missense	possibly damaging	0.72
R1993:Dchs1	UTSW	7	105762548	missense	probably benign	0.00
R2007:Dchs1	UTSW	7	105755325	missense	probably damaging	1.00
R2316:Dchs1	UTSW	7	105764204	missense	possibly damaging	0.71
R2351:Dchs1	UTSW	7	105754094	missense	probably benign
R2474:Dchs1	UTSW	7	105755074	missense	probably benign	0.37
R2474:Dchs1	UTSW	7	105772838	missense	probably damaging	1.00
R3429:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3430:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3737:Dchs1	UTSW	7	105762316	missense	possibly damaging	0.88
R3767:Dchs1	UTSW	7	105757085	missense	possibly damaging	0.67
R3874:Dchs1	UTSW	7	105761635	missense	probably damaging	1.00
R3883:Dchs1	UTSW	7	105762563	missense	probably damaging	1.00
R4105:Dchs1	UTSW	7	105765140	missense	probably damaging	1.00
R4209:Dchs1	UTSW	7	105766190	missense	probably damaging	0.99
R4329:Dchs1	UTSW	7	105753759	missense	probably damaging	1.00
R4516:Dchs1	UTSW	7	105754852	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105754765	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105758973	missense	probably benign
R4588:Dchs1	UTSW	7	105756041	missense	probably benign
R4613:Dchs1	UTSW	7	105772724	missense	probably damaging	1.00
R4632:Dchs1	UTSW	7	105754355	missense	probably benign	0.02
R4696:Dchs1	UTSW	7	105764627	missense	probably damaging	1.00
R4725:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4725:Dchs1	UTSW	7	105765552	missense	probably damaging	1.00
R4738:Dchs1	UTSW	7	105758673	missense	probably damaging	0.96
R4768:Dchs1	UTSW	7	105771620	missense	possibly damaging	0.96
R4784:Dchs1	UTSW	7	105765926	missense	probably damaging	1.00
R4864:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4880:Dchs1	UTSW	7	105755730	missense	probably benign	0.00
R4909:Dchs1	UTSW	7	105766255	missense	probably damaging	1.00
R5102:Dchs1	UTSW	7	105772177	missense	probably benign	0.09
R5109:Dchs1	UTSW	7	105765014	missense	probably benign
R5126:Dchs1	UTSW	7	105753517	missense	probably damaging	1.00
R5149:Dchs1	UTSW	7	105755658	missense	probably damaging	0.98
R5330:Dchs1	UTSW	7	105754602	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105772055	missense	probably damaging	1.00
R5386:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5622:Dchs1	UTSW	7	105755293	missense	probably benign	0.11
R5623:Dchs1	UTSW	7	105772769	missense	probably damaging	1.00
R5708:Dchs1	UTSW	7	105772809	missense	probably damaging	1.00
R5718:Dchs1	UTSW	7	105755748	missense	probably benign	0.01
R5743:Dchs1	UTSW	7	105771596	missense	probably benign
R5759:Dchs1	UTSW	7	105764176	missense	probably damaging	0.99
R5772:Dchs1	UTSW	7	105773040	missense	probably damaging	1.00
R5860:Dchs1	UTSW	7	105772035	missense	probably damaging	1.00
R5916:Dchs1	UTSW	7	105759166	missense	probably damaging	1.00
R5965:Dchs1	UTSW	7	105755925	missense	probably damaging	1.00
R5997:Dchs1	UTSW	7	105754095	missense	probably benign	0.08
R6065:Dchs1	UTSW	7	105755421	missense	probably damaging	1.00
R6136:Dchs1	UTSW	7	105760925	missense	probably benign
R6137:Dchs1	UTSW	7	105765106	missense	probably damaging	0.99
R6324:Dchs1	UTSW	7	105764938	missense	probably benign	0.05
R6363:Dchs1	UTSW	7	105758472	missense	probably benign	0.12
R6466:Dchs1	UTSW	7	105764541	missense	probably benign	0.09
R6544:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R6572:Dchs1	UTSW	7	105758806	missense	possibly damaging	0.94
R6579:Dchs1	UTSW	7	105762913	missense	probably benign	0.17
R6632:Dchs1	UTSW	7	105761878	missense	probably damaging	1.00
R6725:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
R6789:Dchs1	UTSW	7	105757003	missense	possibly damaging	0.61
R6868:Dchs1	UTSW	7	105763503	missense	possibly damaging	0.91
R7058:Dchs1	UTSW	7	105757021	missense	probably benign
R7064:Dchs1	UTSW	7	105763185	missense	probably damaging	0.99
R7076:Dchs1	UTSW	7	105761871	missense	probably benign	0.04
R7191:Dchs1	UTSW	7	105765439	missense	possibly damaging	0.89
R7298:Dchs1	UTSW	7	105755131	nonsense	probably null
R7380:Dchs1	UTSW	7	105758628	missense	probably benign	0.35
R7438:Dchs1	UTSW	7	105754948	missense	probably benign	0.30
R7496:Dchs1	UTSW	7	105761859	missense	probably damaging	1.00
R7534:Dchs1	UTSW	7	105772373	missense	probably benign	0.00
R7604:Dchs1	UTSW	7	105765982	missense	probably damaging	1.00
R7631:Dchs1	UTSW	7	105759238	missense	probably benign
R7821:Dchs1	UTSW	7	105765145	missense	probably benign	0.00
R7834:Dchs1	UTSW	7	105765567	missense	probably benign	0.39
R7841:Dchs1	UTSW	7	105762973	missense	probably benign
R7913:Dchs1	UTSW	7	105759228	missense	possibly damaging	0.61
R8041:Dchs1	UTSW	7	105755188	missense	probably benign	0.45
R8076:Dchs1	UTSW	7	105755921	missense	possibly damaging	0.52
R8076:Dchs1	UTSW	7	105761982	missense	probably damaging	1.00
R8087:Dchs1	UTSW	7	105753499	missense	probably benign	0.41
R8125:Dchs1	UTSW	7	105764882	missense	possibly damaging	0.91
R8223:Dchs1	UTSW	7	105762617	missense	possibly damaging	0.81
R8239:Dchs1	UTSW	7	105765511	missense	probably benign	0.22
R8476:Dchs1	UTSW	7	105758808	missense	probably benign	0.05
R8497:Dchs1	UTSW	7	105758961	missense	probably damaging	1.00
R8770:Dchs1	UTSW	7	105771738	missense	probably damaging	1.00
R8856:Dchs1	UTSW	7	105760857	missense	probably damaging	1.00
R8866:Dchs1	UTSW	7	105755390	missense	probably benign	0.00
R8948:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R8950:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R9029:Dchs1	UTSW	7	105753712	missense	probably benign	0.13
R9039:Dchs1	UTSW	7	105756008	missense	probably benign	0.11
R9081:Dchs1	UTSW	7	105754429	missense	probably benign	0.00
R9134:Dchs1	UTSW	7	105755703	missense	probably damaging	0.96
R9159:Dchs1	UTSW	7	105765919	missense	probably benign
R9162:Dchs1	UTSW	7	105765525	missense	probably damaging	1.00
R9169:Dchs1	UTSW	7	105772907	missense	probably damaging	1.00
R9262:Dchs1	UTSW	7	105755626	missense	probably damaging	1.00
R9292:Dchs1	UTSW	7	105753913	missense	probably damaging	1.00
R9325:Dchs1	UTSW	7	105766195	missense	possibly damaging	0.51
R9376:Dchs1	UTSW	7	105765774	critical splice donor site	probably null
R9392:Dchs1	UTSW	7	105772662	missense	probably benign	0.09
R9619:Dchs1	UTSW	7	105764455	missense	probably benign	0.07
R9680:Dchs1	UTSW	7	105762418	missense	probably damaging	1.00
R9687:Dchs1	UTSW	7	105757984	missense	probably damaging	0.99
R9747:Dchs1	UTSW	7	105763475	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105757693	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105758551	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGATCCTGGGAACTAGCTG -3'
(R):5'- CCAAAGCTGAATTGGGGCAAC -3'

Sequencing Primer
(F):5'- CTGTGGCTAGGAAGTGTGACC -3'
(R):5'- CAGCCACAGTGAGGGTCATTATC -3'

Posted On

2014-06-30