Incidental Mutation 'R1892:Abca14'
ID 211601
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 039912-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1892 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119815561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 270 (A270T)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: A270T

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: A270T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb7 A T X: 103,386,142 (GRCm39) H97Q probably damaging Het
Adat3 T C 10: 80,442,249 (GRCm39) L29P probably damaging Het
AI987944 A T 7: 41,024,020 (GRCm39) C320S probably damaging Het
Asic4 C T 1: 75,446,126 (GRCm39) R285W probably damaging Het
Asic5 A T 3: 81,928,293 (GRCm39) I419L probably damaging Het
Batf A G 12: 85,736,102 (GRCm39) K42E probably damaging Het
Bcar3 A G 3: 122,301,785 (GRCm39) N160S probably benign Het
Bco2 C A 9: 50,461,863 (GRCm39) G47V probably damaging Het
Bicc1 T G 10: 70,794,614 (GRCm39) K181T probably damaging Het
Brinp2 A G 1: 158,082,542 (GRCm39) probably null Het
Cacng8 A G 7: 3,463,568 (GRCm39) D240G possibly damaging Het
Calca A G 7: 114,232,962 (GRCm39) Y96H probably damaging Het
Cdh1 A T 8: 107,390,882 (GRCm39) K666I possibly damaging Het
Cdh16 A T 8: 105,344,631 (GRCm39) I500N possibly damaging Het
Chst14 A G 2: 118,757,830 (GRCm39) Y208C probably damaging Het
Chst9 T C 18: 15,586,017 (GRCm39) H182R probably damaging Het
Clk2 A G 3: 89,082,502 (GRCm39) I367M possibly damaging Het
Cobl G C 11: 12,203,258 (GRCm39) S1066W probably damaging Het
Ctcfl A G 2: 172,960,478 (GRCm39) V35A probably benign Het
Dchs1 G T 7: 105,413,363 (GRCm39) H1151N probably benign Het
Dennd1c T C 17: 57,374,083 (GRCm39) T529A probably benign Het
Dnah11 A T 12: 118,070,209 (GRCm39) V1532D possibly damaging Het
Dync1h1 A G 12: 110,612,738 (GRCm39) Y2871C probably damaging Het
Dytn T C 1: 63,716,420 (GRCm39) E51G probably benign Het
Esd C T 14: 74,987,113 (GRCm39) A266V probably damaging Het
Gli1 T C 10: 127,165,975 (GRCm39) M1093V possibly damaging Het
Gm15446 A G 5: 110,091,253 (GRCm39) K502E probably damaging Het
Gm4076 T A 13: 85,275,447 (GRCm39) noncoding transcript Het
Gm9830 A G 9: 44,375,825 (GRCm39) noncoding transcript Het
Gm9938 G A 19: 23,701,955 (GRCm39) probably benign Het
Grhl1 G A 12: 24,634,909 (GRCm39) R245H probably damaging Het
Hnrnpul1 A T 7: 25,426,191 (GRCm39) D553E probably benign Het
Hpn G A 7: 30,798,468 (GRCm39) Q415* probably null Het
Hsd11b1 T G 1: 192,906,068 (GRCm39) M175L probably benign Het
Htra1 G A 7: 130,586,799 (GRCm39) V461I possibly damaging Het
Il1rl2 A G 1: 40,366,694 (GRCm39) H76R probably damaging Het
Insrr G A 3: 87,721,184 (GRCm39) V1112M probably damaging Het
Ints9 T C 14: 65,257,872 (GRCm39) S351P probably benign Het
Itgav T A 2: 83,601,680 (GRCm39) N350K probably damaging Het
Kdm4d C A 9: 14,375,613 (GRCm39) V82L probably benign Het
Klc1 T C 12: 111,748,261 (GRCm39) probably null Het
Kmt5c T A 7: 4,745,714 (GRCm39) C69* probably null Het
Lgals3 T G 14: 47,622,164 (GRCm39) N193K possibly damaging Het
Morc2b T A 17: 33,354,748 (GRCm39) D1008V probably damaging Het
Mpg C T 11: 32,181,720 (GRCm39) Q243* probably null Het
Muc15 C T 2: 110,567,697 (GRCm39) R281* probably null Het
Ncstn CAGCTCCACGAAG CAG 1: 171,899,038 (GRCm39) probably null Het
Nek5 A G 8: 22,597,745 (GRCm39) M278T probably benign Het
Npas2 A G 1: 39,384,503 (GRCm39) T599A probably benign Het
Nrf1 A G 6: 30,144,787 (GRCm39) D519G probably null Het
Nup43 A G 10: 7,549,373 (GRCm39) H176R probably damaging Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or10j3 T C 1: 173,031,795 (GRCm39) Y291H probably damaging Het
Or5p72 A T 7: 108,022,147 (GRCm39) Y123F possibly damaging Het
Or6c75 A C 10: 129,336,902 (GRCm39) I50L probably benign Het
Perm1 C T 4: 156,302,340 (GRCm39) R295C probably benign Het
Pik3ip1 G T 11: 3,283,304 (GRCm39) A135S probably damaging Het
Pira13 A C 7: 3,827,573 (GRCm39) C195G probably benign Het
Ppp4c A G 7: 126,385,452 (GRCm39) V119A probably damaging Het
Prepl A G 17: 85,395,878 (GRCm39) Y35H possibly damaging Het
Ptpn13 A G 5: 103,649,545 (GRCm39) Y316C possibly damaging Het
Pxk C T 14: 8,151,507 (GRCm38) R441* probably null Het
Ranbp2 T C 10: 58,299,921 (GRCm39) V491A probably benign Het
Ranbp9 C A 13: 43,569,933 (GRCm39) C495F possibly damaging Het
Rfx8 A T 1: 39,709,746 (GRCm39) probably null Het
Rnf111 T A 9: 70,383,656 (GRCm39) K92N probably damaging Het
Rtn1 A G 12: 72,259,337 (GRCm39) I772T probably damaging Het
Ryr2 T A 13: 11,673,844 (GRCm39) K72* probably null Het
Sergef A T 7: 46,264,040 (GRCm39) probably null Het
Sez6l T C 5: 112,620,665 (GRCm39) N305S probably damaging Het
Slc40a1 A T 1: 45,950,302 (GRCm39) C383* probably null Het
Stab2 C T 10: 86,773,913 (GRCm39) C806Y probably damaging Het
Stard9 A G 2: 120,524,189 (GRCm39) T795A probably benign Het
Stk31 T C 6: 49,415,408 (GRCm39) I536T probably damaging Het
Stox1 T A 10: 62,501,178 (GRCm39) T461S possibly damaging Het
Suv39h2 T C 2: 3,460,805 (GRCm39) Y219C probably damaging Het
Tap1 T G 17: 34,413,915 (GRCm39) D643E probably damaging Het
Tbc1d2b T A 9: 90,100,996 (GRCm39) I665F probably damaging Het
Tdrd6 T C 17: 43,935,696 (GRCm39) N1784S probably benign Het
Tmem14c T C 13: 41,174,633 (GRCm39) F81L possibly damaging Het
Tnrc6c A G 11: 117,605,188 (GRCm39) N108D probably benign Het
Tox3 A T 8: 90,996,869 (GRCm39) N131K probably benign Het
Tspear T A 10: 77,706,308 (GRCm39) D359E probably benign Het
Ttc9 A G 12: 81,678,551 (GRCm39) I125V probably benign Het
Ttn A T 2: 76,728,531 (GRCm39) probably benign Het
Ubn2 C T 6: 38,468,226 (GRCm39) S980F probably damaging Het
Vcf1 G T 11: 113,554,212 (GRCm39) P161H probably damaging Het
Zfp362 T A 4: 128,684,057 (GRCm39) T30S probably benign Het
Zfp385c A C 11: 100,528,630 (GRCm39) H32Q probably damaging Het
Zfp870 A T 17: 33,102,863 (GRCm39) H156Q possibly damaging Het
Zfp873 T C 10: 81,897,080 (GRCm39) C641R probably damaging Het
Zfp950 A T 19: 61,107,549 (GRCm39) H511Q probably benign Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTATCGTGCAGCATTCAGTAGAC -3'
(R):5'- AGAAAATTGATCGTTGGCCCTG -3'

Sequencing Primer
(F):5'- CAAGGCCATCATGATGTATCACAGTG -3'
(R):5'- ACTCCAGGCAGCCCATGATTG -3'
Posted On 2014-06-30