Incidental Mutation 'R1892:Gli1'
ID211625
Institutional Source Beutler Lab
Gene Symbol Gli1
Ensembl Gene ENSMUSG00000025407
Gene NameGLI-Kruppel family member GLI1
SynonymsZfp-5, Zfp5
MMRRC Submission 039912-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1892 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127329882-127341974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127330106 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1093 (M1093V)
Ref Sequence ENSEMBL: ENSMUSP00000026474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000069548] [ENSMUST00000219026] [ENSMUST00000219511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026474
AA Change: M1093V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407
AA Change: M1093V

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069548
SMART Domains Protein: ENSMUSP00000066455
Gene: ENSMUSG00000040345

DomainStartEndE-ValueType
PH 60 175 8.19e-10 SMART
RhoGAP 276 469 1.94e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218656
Predicted Effect probably benign
Transcript: ENSMUST00000219026
Predicted Effect probably benign
Transcript: ENSMUST00000219511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219808
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal, but homozygotes that are also heterozygous for a Gli2 knockout die soon after birth with multiple defects, while Gli2 knockout heterozygotes are normally viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,216,338 A270T probably benign Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Adat3 T C 10: 80,606,415 L29P probably damaging Het
AI987944 A T 7: 41,374,596 C320S probably damaging Het
Asic4 C T 1: 75,469,482 R285W probably damaging Het
Asic5 A T 3: 82,020,986 I419L probably damaging Het
Batf A G 12: 85,689,328 K42E probably damaging Het
Bcar3 A G 3: 122,508,136 N160S probably benign Het
Bco2 C A 9: 50,550,563 G47V probably damaging Het
Bicc1 T G 10: 70,958,784 K181T probably damaging Het
Brinp2 A G 1: 158,254,972 probably null Het
Cacng8 A G 7: 3,415,052 D240G possibly damaging Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cdh1 A T 8: 106,664,250 K666I possibly damaging Het
Cdh16 A T 8: 104,617,999 I500N possibly damaging Het
Chst14 A G 2: 118,927,349 Y208C probably damaging Het
Chst9 T C 18: 15,452,960 H182R probably damaging Het
Clk2 A G 3: 89,175,195 I367M possibly damaging Het
Cobl G C 11: 12,253,258 S1066W probably damaging Het
Ctcfl A G 2: 173,118,685 V35A probably benign Het
Dchs1 G T 7: 105,764,156 H1151N probably benign Het
Dennd1c T C 17: 57,067,083 T529A probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Dync1h1 A G 12: 110,646,304 Y2871C probably damaging Het
Dytn T C 1: 63,677,261 E51G probably benign Het
Esd C T 14: 74,749,673 A266V probably damaging Het
Fam104a G T 11: 113,663,386 P161H probably damaging Het
Gm15446 A G 5: 109,943,387 K502E probably damaging Het
Gm15448 A C 7: 3,824,574 C195G probably benign Het
Gm4076 T A 13: 85,127,328 noncoding transcript Het
Gm9830 A G 9: 44,464,528 noncoding transcript Het
Gm9938 G A 19: 23,724,591 probably benign Het
Grhl1 G A 12: 24,584,910 R245H probably damaging Het
Hnrnpul1 A T 7: 25,726,766 D553E probably benign Het
Hpn G A 7: 31,099,043 Q415* probably null Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il1rl2 A G 1: 40,327,534 H76R probably damaging Het
Insrr G A 3: 87,813,877 V1112M probably damaging Het
Ints9 T C 14: 65,020,423 S351P probably benign Het
Itgav T A 2: 83,771,336 N350K probably damaging Het
Kdm4d C A 9: 14,464,317 V82L probably benign Het
Klc1 T C 12: 111,781,827 probably null Het
Kmt5c T A 7: 4,742,715 C69* probably null Het
Lgals3 T G 14: 47,384,707 N193K possibly damaging Het
Morc2b T A 17: 33,135,774 D1008V probably damaging Het
Mpg C T 11: 32,231,720 Q243* probably null Het
Muc15 C T 2: 110,737,352 R281* probably null Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nek5 A G 8: 22,107,729 M278T probably benign Het
Npas2 A G 1: 39,345,422 T599A probably benign Het
Nrf1 A G 6: 30,144,788 D519G probably null Het
Nup43 A G 10: 7,673,609 H176R probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr218 T C 1: 173,204,228 Y291H probably damaging Het
Olfr497 A T 7: 108,422,940 Y123F possibly damaging Het
Olfr790 A C 10: 129,501,033 I50L probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Pik3ip1 G T 11: 3,333,304 A135S probably damaging Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Prepl A G 17: 85,088,450 Y35H possibly damaging Het
Ptpn13 A G 5: 103,501,679 Y316C possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Ranbp2 T C 10: 58,464,099 V491A probably benign Het
Ranbp9 C A 13: 43,416,457 C495F possibly damaging Het
Rfx8 A T 1: 39,670,586 probably null Het
Rnf111 T A 9: 70,476,374 K92N probably damaging Het
Rtn1 A G 12: 72,212,563 I772T probably damaging Het
Ryr2 T A 13: 11,658,958 K72* probably null Het
Sergef A T 7: 46,614,616 probably null Het
Sez6l T C 5: 112,472,799 N305S probably damaging Het
Slc40a1 A T 1: 45,911,142 C383* probably null Het
Stab2 C T 10: 86,938,049 C806Y probably damaging Het
Stard9 A G 2: 120,693,708 T795A probably benign Het
Stk31 T C 6: 49,438,474 I536T probably damaging Het
Stox1 T A 10: 62,665,399 T461S possibly damaging Het
Suv39h2 T C 2: 3,459,768 Y219C probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Tbc1d2b T A 9: 90,218,943 I665F probably damaging Het
Tdrd6 T C 17: 43,624,805 N1784S probably benign Het
Tmem14c T C 13: 41,021,157 F81L possibly damaging Het
Tnrc6c A G 11: 117,714,362 N108D probably benign Het
Tox3 A T 8: 90,270,241 N131K probably benign Het
Tspear T A 10: 77,870,474 D359E probably benign Het
Ttc9 A G 12: 81,631,777 I125V probably benign Het
Ttn A T 2: 76,898,187 probably benign Het
Ubn2 C T 6: 38,491,291 S980F probably damaging Het
Zfp362 T A 4: 128,790,264 T30S probably benign Het
Zfp385c A C 11: 100,637,804 H32Q probably damaging Het
Zfp870 A T 17: 32,883,889 H156Q possibly damaging Het
Zfp873 T C 10: 82,061,246 C641R probably damaging Het
Zfp950 A T 19: 61,119,111 H511Q probably benign Het
Other mutations in Gli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Gli1 APN 10 127332478 missense probably damaging 1.00
IGL01824:Gli1 APN 10 127336527 missense probably benign 0.44
IGL02134:Gli1 APN 10 127336500 missense probably benign 0.00
IGL02508:Gli1 APN 10 127337092 missense probably benign 0.14
IGL02931:Gli1 APN 10 127332410 missense probably benign 0.00
R0099:Gli1 UTSW 10 127336006 missense probably damaging 1.00
R0590:Gli1 UTSW 10 127331563 missense possibly damaging 0.82
R0792:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1169:Gli1 UTSW 10 127338451 missense probably damaging 1.00
R1519:Gli1 UTSW 10 127334269 missense possibly damaging 0.93
R1522:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1550:Gli1 UTSW 10 127338516 missense probably damaging 1.00
R1592:Gli1 UTSW 10 127331329 missense probably damaging 0.97
R1879:Gli1 UTSW 10 127333737 missense probably damaging 1.00
R1934:Gli1 UTSW 10 127331239 missense possibly damaging 0.65
R2049:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R2088:Gli1 UTSW 10 127331500 missense probably damaging 1.00
R2141:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R3803:Gli1 UTSW 10 127338065 splice site probably benign
R3873:Gli1 UTSW 10 127331356 missense probably damaging 1.00
R3874:Gli1 UTSW 10 127330219 missense probably damaging 1.00
R3899:Gli1 UTSW 10 127336666 missense possibly damaging 0.64
R4703:Gli1 UTSW 10 127330855 missense possibly damaging 0.88
R5552:Gli1 UTSW 10 127330262 missense probably benign 0.00
R5686:Gli1 UTSW 10 127337436 missense probably benign 0.01
R5812:Gli1 UTSW 10 127337415 missense probably damaging 1.00
R6053:Gli1 UTSW 10 127334315 missense probably damaging 1.00
R7088:Gli1 UTSW 10 127335999 missense probably damaging 1.00
R7162:Gli1 UTSW 10 127332437 missense probably benign
Z1177:Gli1 UTSW 10 127334257 missense not run
Z1177:Gli1 UTSW 10 127335998 missense not run
Z1177:Gli1 UTSW 10 127336691 missense not run
Predicted Primers PCR Primer
(F):5'- CAGGTGATGCTTGTTCTCAGTATTC -3'
(R):5'- AGGTGTGTAACGCTCTGGAC -3'

Sequencing Primer
(F):5'- GTTCTCAGTATTCCTTTATTGTCAGG -3'
(R):5'- GGACTCTCTTGACCTGGACAAC -3'
Posted On2014-06-30