Mutagenetix > Incidental Mutations

Incidental Mutation 'R1892:Grhl1'

211633

Institutional Source

Beutler Lab

Gene Symbol

Grhl1

Ensembl Gene

ENSMUSG00000020656

Gene Name

grainyhead like transcription factor 1

Synonyms

LBP-32, p70 MGR, p61 MGR, Tcfcp2l2

MMRRC Submission

039912-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24572283-24617391 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24584910 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 245 (R245H)

Ref Sequence

ENSEMBL: ENSMUSP00000020985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020985] [ENSMUST00000085553]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020985
AA Change: R245H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020985
Gene: ENSMUSG00000020656
AA Change: R245H

Domain	Start	End	E-Value	Type
Pfam:CP2	133	362	1.8e-87	PFAM
low complexity region	406	421	N/A	INTRINSIC
low complexity region	488	500	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000085553
AA Change: R327H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082689
Gene: ENSMUSG00000020656
AA Change: R327H

Domain	Start	End	E-Value	Type
Pfam:CP2	228	442	1.9e-82	PFAM
low complexity region	488	503	N/A	INTRINSIC
low complexity region	570	582	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221426

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223442

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display alopecia or sparse hair, abnormal hair follicle root sheaths, thickening of the cornified layer on the paws, and postnatal growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,216,338	A270T	probably benign	Het
Abcb7	A	T	X: 104,342,536	H97Q	probably damaging	Het
Adat3	T	C	10: 80,606,415	L29P	probably damaging	Het
AI987944	A	T	7: 41,374,596	C320S	probably damaging	Het
Asic4	C	T	1: 75,469,482	R285W	probably damaging	Het
Asic5	A	T	3: 82,020,986	I419L	probably damaging	Het
Batf	A	G	12: 85,689,328	K42E	probably damaging	Het
Bcar3	A	G	3: 122,508,136	N160S	probably benign	Het
Bco2	C	A	9: 50,550,563	G47V	probably damaging	Het
Bicc1	T	G	10: 70,958,784	K181T	probably damaging	Het
Brinp2	A	G	1: 158,254,972		probably null	Het
Cacng8	A	G	7: 3,415,052	D240G	possibly damaging	Het
Calca	A	G	7: 114,633,727	Y96H	probably damaging	Het
Cdh1	A	T	8: 106,664,250	K666I	possibly damaging	Het
Cdh16	A	T	8: 104,617,999	I500N	possibly damaging	Het
Chst14	A	G	2: 118,927,349	Y208C	probably damaging	Het
Chst9	T	C	18: 15,452,960	H182R	probably damaging	Het
Clk2	A	G	3: 89,175,195	I367M	possibly damaging	Het
Cobl	G	C	11: 12,253,258	S1066W	probably damaging	Het
Ctcfl	A	G	2: 173,118,685	V35A	probably benign	Het
Dchs1	G	T	7: 105,764,156	H1151N	probably benign	Het
Dennd1c	T	C	17: 57,067,083	T529A	probably benign	Het
Dnah11	A	T	12: 118,106,474	V1532D	possibly damaging	Het
Dync1h1	A	G	12: 110,646,304	Y2871C	probably damaging	Het
Dytn	T	C	1: 63,677,261	E51G	probably benign	Het
Esd	C	T	14: 74,749,673	A266V	probably damaging	Het
Fam104a	G	T	11: 113,663,386	P161H	probably damaging	Het
Gli1	T	C	10: 127,330,106	M1093V	possibly damaging	Het
Gm15446	A	G	5: 109,943,387	K502E	probably damaging	Het
Gm15448	A	C	7: 3,824,574	C195G	probably benign	Het
Gm4076	T	A	13: 85,127,328		noncoding transcript	Het
Gm9830	A	G	9: 44,464,528		noncoding transcript	Het
Gm9938	G	A	19: 23,724,591		probably benign	Het
Hnrnpul1	A	T	7: 25,726,766	D553E	probably benign	Het
Hpn	G	A	7: 31,099,043	Q415*	probably null	Het
Hsd11b1	T	G	1: 193,223,760	M175L	probably benign	Het
Htra1	G	A	7: 130,985,069	V461I	possibly damaging	Het
Il1rl2	A	G	1: 40,327,534	H76R	probably damaging	Het
Insrr	G	A	3: 87,813,877	V1112M	probably damaging	Het
Ints9	T	C	14: 65,020,423	S351P	probably benign	Het
Itgav	T	A	2: 83,771,336	N350K	probably damaging	Het
Kdm4d	C	A	9: 14,464,317	V82L	probably benign	Het
Klc1	T	C	12: 111,781,827		probably null	Het
Kmt5c	T	A	7: 4,742,715	C69*	probably null	Het
Lgals3	T	G	14: 47,384,707	N193K	possibly damaging	Het
Morc2b	T	A	17: 33,135,774	D1008V	probably damaging	Het
Mpg	C	T	11: 32,231,720	Q243*	probably null	Het
Muc15	C	T	2: 110,737,352	R281*	probably null	Het
Ncstn	CAGCTCCACGAAG	CAG	1: 172,071,471		probably null	Het
Nek5	A	G	8: 22,107,729	M278T	probably benign	Het
Npas2	A	G	1: 39,345,422	T599A	probably benign	Het
Nrf1	A	G	6: 30,144,788	D519G	probably null	Het
Nup43	A	G	10: 7,673,609	H176R	probably damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr218	T	C	1: 173,204,228	Y291H	probably damaging	Het
Olfr497	A	T	7: 108,422,940	Y123F	possibly damaging	Het
Olfr790	A	C	10: 129,501,033	I50L	probably benign	Het
Perm1	C	T	4: 156,217,883	R295C	probably benign	Het
Pik3ip1	G	T	11: 3,333,304	A135S	probably damaging	Het
Ppp4c	A	G	7: 126,786,280	V119A	probably damaging	Het
Prepl	A	G	17: 85,088,450	Y35H	possibly damaging	Het
Ptpn13	A	G	5: 103,501,679	Y316C	possibly damaging	Het
Pxk	C	T	14: 8,151,507	R441*	probably null	Het
Ranbp2	T	C	10: 58,464,099	V491A	probably benign	Het
Ranbp9	C	A	13: 43,416,457	C495F	possibly damaging	Het
Rfx8	A	T	1: 39,670,586		probably null	Het
Rnf111	T	A	9: 70,476,374	K92N	probably damaging	Het
Rtn1	A	G	12: 72,212,563	I772T	probably damaging	Het
Ryr2	T	A	13: 11,658,958	K72*	probably null	Het
Sergef	A	T	7: 46,614,616		probably null	Het
Sez6l	T	C	5: 112,472,799	N305S	probably damaging	Het
Slc40a1	A	T	1: 45,911,142	C383*	probably null	Het
Stab2	C	T	10: 86,938,049	C806Y	probably damaging	Het
Stard9	A	G	2: 120,693,708	T795A	probably benign	Het
Stk31	T	C	6: 49,438,474	I536T	probably damaging	Het
Stox1	T	A	10: 62,665,399	T461S	possibly damaging	Het
Suv39h2	T	C	2: 3,459,768	Y219C	probably damaging	Het
Tap1	T	G	17: 34,194,941	D643E	probably damaging	Het
Tbc1d2b	T	A	9: 90,218,943	I665F	probably damaging	Het
Tdrd6	T	C	17: 43,624,805	N1784S	probably benign	Het
Tmem14c	T	C	13: 41,021,157	F81L	possibly damaging	Het
Tnrc6c	A	G	11: 117,714,362	N108D	probably benign	Het
Tox3	A	T	8: 90,270,241	N131K	probably benign	Het
Tspear	T	A	10: 77,870,474	D359E	probably benign	Het
Ttc9	A	G	12: 81,631,777	I125V	probably benign	Het
Ttn	A	T	2: 76,898,187		probably benign	Het
Ubn2	C	T	6: 38,491,291	S980F	probably damaging	Het
Zfp362	T	A	4: 128,790,264	T30S	probably benign	Het
Zfp385c	A	C	11: 100,637,804	H32Q	probably damaging	Het
Zfp870	A	T	17: 32,883,889	H156Q	possibly damaging	Het
Zfp873	T	C	10: 82,061,246	C641R	probably damaging	Het
Zfp950	A	T	19: 61,119,111	H511Q	probably benign	Het

Other mutations in Grhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Grhl1	APN	12	24612170	missense	probably damaging	1.00
IGL01104:Grhl1	APN	12	24584454	missense	probably damaging	1.00
IGL01335:Grhl1	APN	12	24608058	missense	probably damaging	1.00
IGL01660:Grhl1	APN	12	24608578	splice site	probably null
IGL01725:Grhl1	APN	12	24609748	splice site	probably benign
IGL02869:Grhl1	APN	12	24581491	missense	probably damaging	1.00
bandit	UTSW	12	24578027	missense	probably benign	0.31
R0048:Grhl1	UTSW	12	24612151	splice site	probably benign
R0373:Grhl1	UTSW	12	24581515	missense	probably benign	0.00
R0432:Grhl1	UTSW	12	24582919	missense	probably benign	0.29
R0442:Grhl1	UTSW	12	24612170	missense	probably damaging	1.00
R1531:Grhl1	UTSW	12	24582963	critical splice donor site	probably null
R1646:Grhl1	UTSW	12	24611861	missense	possibly damaging	0.64
R1874:Grhl1	UTSW	12	24586156	splice site	probably benign
R1908:Grhl1	UTSW	12	24608556	missense	probably damaging	0.99
R2051:Grhl1	UTSW	12	24586152	critical splice donor site	probably null
R2199:Grhl1	UTSW	12	24612170	missense	probably damaging	1.00
R2233:Grhl1	UTSW	12	24608511	missense	probably damaging	0.98
R3803:Grhl1	UTSW	12	24584919	missense	probably damaging	1.00
R3864:Grhl1	UTSW	12	24615930	makesense	probably null
R4227:Grhl1	UTSW	12	24611851	missense	probably benign
R4682:Grhl1	UTSW	12	24608433	missense	probably benign	0.00
R4709:Grhl1	UTSW	12	24586133	missense	possibly damaging	0.57
R5096:Grhl1	UTSW	12	24603050	missense	probably damaging	1.00
R5149:Grhl1	UTSW	12	24612179	small deletion	probably benign
R5580:Grhl1	UTSW	12	24609740	missense	probably benign	0.00
R6035:Grhl1	UTSW	12	24608450	missense	probably benign	0.00
R6035:Grhl1	UTSW	12	24608450	missense	probably benign	0.00
R6110:Grhl1	UTSW	12	24580747	splice site	probably null
R6351:Grhl1	UTSW	12	24584858	missense	probably damaging	0.98
R7018:Grhl1	UTSW	12	24575997	missense	possibly damaging	0.47
R8211:Grhl1	UTSW	12	24586152	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGCCTTGCTTTAAGCCTTAAC -3'
(R):5'- GTCACATGGCAAACCTCTGC -3'

Sequencing Primer
(F):5'- CTCTGTGATCTAACAACAAGGGTC -3'
(R):5'- GTAAGGACAGAGCCCTGATTCC -3'

Posted On

2014-06-30