Mutagenetix > Incidental Mutations

Incidental Mutation 'R1892:Rtn1'

211635

Institutional Source

Beutler Lab

Gene Symbol

Rtn1

Ensembl Gene

ENSMUSG00000021087

Gene Name

reticulon 1

Synonyms

Rtn1-c, 0710005K15Rik, Nsp, Rtn1-b, Rtn1-a, 4930441F12Rik

MMRRC Submission

039912-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1892 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72211752-72409054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72212563 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 772 (I772T)

Ref Sequence

ENSEMBL: ENSMUSP00000077594 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021497] [ENSMUST00000078505] [ENSMUST00000137990]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021497
AA Change: I200T

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021497
Gene: ENSMUSG00000021087
AA Change: I200T

Domain	Start	End	E-Value	Type
Pfam:Reticulon	21	191	1.2e-62	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000078505
AA Change: I772T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077594
Gene: ENSMUSG00000021087
AA Change: I772T

Domain	Start	End	E-Value	Type
low complexity region	135	152	N/A	INTRINSIC
low complexity region	217	226	N/A	INTRINSIC
low complexity region	327	341	N/A	INTRINSIC
low complexity region	438	448	N/A	INTRINSIC
low complexity region	473	480	N/A	INTRINSIC
low complexity region	574	586	N/A	INTRINSIC
Pfam:Reticulon	593	757	2.2e-46	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137990
AA Change: I245T

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120033
Gene: ENSMUSG00000021087
AA Change: I245T

Domain	Start	End	E-Value	Type
low complexity region	11	32	N/A	INTRINSIC
low complexity region	38	50	N/A	INTRINSIC
Pfam:Reticulon	66	236	2.3e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150156

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	G	A	7: 120,216,338	A270T	probably benign	Het
Abcb7	A	T	X: 104,342,536	H97Q	probably damaging	Het
Adat3	T	C	10: 80,606,415	L29P	probably damaging	Het
AI987944	A	T	7: 41,374,596	C320S	probably damaging	Het
Asic4	C	T	1: 75,469,482	R285W	probably damaging	Het
Asic5	A	T	3: 82,020,986	I419L	probably damaging	Het
Batf	A	G	12: 85,689,328	K42E	probably damaging	Het
Bcar3	A	G	3: 122,508,136	N160S	probably benign	Het
Bco2	C	A	9: 50,550,563	G47V	probably damaging	Het
Bicc1	T	G	10: 70,958,784	K181T	probably damaging	Het
Brinp2	A	G	1: 158,254,972		probably null	Het
Cacng8	A	G	7: 3,415,052	D240G	possibly damaging	Het
Calca	A	G	7: 114,633,727	Y96H	probably damaging	Het
Cdh1	A	T	8: 106,664,250	K666I	possibly damaging	Het
Cdh16	A	T	8: 104,617,999	I500N	possibly damaging	Het
Chst14	A	G	2: 118,927,349	Y208C	probably damaging	Het
Chst9	T	C	18: 15,452,960	H182R	probably damaging	Het
Clk2	A	G	3: 89,175,195	I367M	possibly damaging	Het
Cobl	G	C	11: 12,253,258	S1066W	probably damaging	Het
Ctcfl	A	G	2: 173,118,685	V35A	probably benign	Het
Dchs1	G	T	7: 105,764,156	H1151N	probably benign	Het
Dennd1c	T	C	17: 57,067,083	T529A	probably benign	Het
Dnah11	A	T	12: 118,106,474	V1532D	possibly damaging	Het
Dync1h1	A	G	12: 110,646,304	Y2871C	probably damaging	Het
Dytn	T	C	1: 63,677,261	E51G	probably benign	Het
Esd	C	T	14: 74,749,673	A266V	probably damaging	Het
Fam104a	G	T	11: 113,663,386	P161H	probably damaging	Het
Gli1	T	C	10: 127,330,106	M1093V	possibly damaging	Het
Gm15446	A	G	5: 109,943,387	K502E	probably damaging	Het
Gm15448	A	C	7: 3,824,574	C195G	probably benign	Het
Gm4076	T	A	13: 85,127,328		noncoding transcript	Het
Gm9830	A	G	9: 44,464,528		noncoding transcript	Het
Gm9938	G	A	19: 23,724,591		probably benign	Het
Grhl1	G	A	12: 24,584,910	R245H	probably damaging	Het
Hnrnpul1	A	T	7: 25,726,766	D553E	probably benign	Het
Hpn	G	A	7: 31,099,043	Q415*	probably null	Het
Hsd11b1	T	G	1: 193,223,760	M175L	probably benign	Het
Htra1	G	A	7: 130,985,069	V461I	possibly damaging	Het
Il1rl2	A	G	1: 40,327,534	H76R	probably damaging	Het
Insrr	G	A	3: 87,813,877	V1112M	probably damaging	Het
Ints9	T	C	14: 65,020,423	S351P	probably benign	Het
Itgav	T	A	2: 83,771,336	N350K	probably damaging	Het
Kdm4d	C	A	9: 14,464,317	V82L	probably benign	Het
Klc1	T	C	12: 111,781,827		probably null	Het
Kmt5c	T	A	7: 4,742,715	C69*	probably null	Het
Lgals3	T	G	14: 47,384,707	N193K	possibly damaging	Het
Morc2b	T	A	17: 33,135,774	D1008V	probably damaging	Het
Mpg	C	T	11: 32,231,720	Q243*	probably null	Het
Muc15	C	T	2: 110,737,352	R281*	probably null	Het
Ncstn	CAGCTCCACGAAG	CAG	1: 172,071,471		probably null	Het
Nek5	A	G	8: 22,107,729	M278T	probably benign	Het
Npas2	A	G	1: 39,345,422	T599A	probably benign	Het
Nrf1	A	G	6: 30,144,788	D519G	probably null	Het
Nup43	A	G	10: 7,673,609	H176R	probably damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr218	T	C	1: 173,204,228	Y291H	probably damaging	Het
Olfr497	A	T	7: 108,422,940	Y123F	possibly damaging	Het
Olfr790	A	C	10: 129,501,033	I50L	probably benign	Het
Perm1	C	T	4: 156,217,883	R295C	probably benign	Het
Pik3ip1	G	T	11: 3,333,304	A135S	probably damaging	Het
Ppp4c	A	G	7: 126,786,280	V119A	probably damaging	Het
Prepl	A	G	17: 85,088,450	Y35H	possibly damaging	Het
Ptpn13	A	G	5: 103,501,679	Y316C	possibly damaging	Het
Pxk	C	T	14: 8,151,507	R441*	probably null	Het
Ranbp2	T	C	10: 58,464,099	V491A	probably benign	Het
Ranbp9	C	A	13: 43,416,457	C495F	possibly damaging	Het
Rfx8	A	T	1: 39,670,586		probably null	Het
Rnf111	T	A	9: 70,476,374	K92N	probably damaging	Het
Ryr2	T	A	13: 11,658,958	K72*	probably null	Het
Sergef	A	T	7: 46,614,616		probably null	Het
Sez6l	T	C	5: 112,472,799	N305S	probably damaging	Het
Slc40a1	A	T	1: 45,911,142	C383*	probably null	Het
Stab2	C	T	10: 86,938,049	C806Y	probably damaging	Het
Stard9	A	G	2: 120,693,708	T795A	probably benign	Het
Stk31	T	C	6: 49,438,474	I536T	probably damaging	Het
Stox1	T	A	10: 62,665,399	T461S	possibly damaging	Het
Suv39h2	T	C	2: 3,459,768	Y219C	probably damaging	Het
Tap1	T	G	17: 34,194,941	D643E	probably damaging	Het
Tbc1d2b	T	A	9: 90,218,943	I665F	probably damaging	Het
Tdrd6	T	C	17: 43,624,805	N1784S	probably benign	Het
Tmem14c	T	C	13: 41,021,157	F81L	possibly damaging	Het
Tnrc6c	A	G	11: 117,714,362	N108D	probably benign	Het
Tox3	A	T	8: 90,270,241	N131K	probably benign	Het
Tspear	T	A	10: 77,870,474	D359E	probably benign	Het
Ttc9	A	G	12: 81,631,777	I125V	probably benign	Het
Ttn	A	T	2: 76,898,187		probably benign	Het
Ubn2	C	T	6: 38,491,291	S980F	probably damaging	Het
Zfp362	T	A	4: 128,790,264	T30S	probably benign	Het
Zfp385c	A	C	11: 100,637,804	H32Q	probably damaging	Het
Zfp870	A	T	17: 32,883,889	H156Q	possibly damaging	Het
Zfp873	T	C	10: 82,061,246	C641R	probably damaging	Het
Zfp950	A	T	19: 61,119,111	H511Q	probably benign	Het

Other mutations in Rtn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Rtn1	APN	12	72408511	missense	probably benign	0.18
IGL01335:Rtn1	APN	12	72308350	missense	probably benign
IGL01394:Rtn1	APN	12	72308416	missense	probably benign	0.00
IGL01551:Rtn1	APN	12	72216935	missense	possibly damaging	0.63
IGL01865:Rtn1	APN	12	72219300	missense	probably damaging	1.00
IGL02585:Rtn1	APN	12	72308155	critical splice donor site	probably null
PIT4802001:Rtn1	UTSW	12	72304326	missense	probably benign	0.21
R0104:Rtn1	UTSW	12	72308845	missense	probably damaging	0.99
R0866:Rtn1	UTSW	12	72308382	nonsense	probably null
R1099:Rtn1	UTSW	12	72304467	splice site	probably null
R1438:Rtn1	UTSW	12	72304413	missense	probably damaging	0.98
R1610:Rtn1	UTSW	12	72219279	missense	possibly damaging	0.90
R1694:Rtn1	UTSW	12	72223524	missense	probably damaging	1.00
R1869:Rtn1	UTSW	12	72308168	missense	probably damaging	1.00
R1888:Rtn1	UTSW	12	72236533	intron	probably benign
R1889:Rtn1	UTSW	12	72304410	missense	possibly damaging	0.87
R2418:Rtn1	UTSW	12	72304278	missense	probably benign
R2760:Rtn1	UTSW	12	72408362	missense	probably benign	0.00
R2973:Rtn1	UTSW	12	72223389	missense	probably damaging	1.00
R4567:Rtn1	UTSW	12	72212487	utr 3 prime	probably benign
R4880:Rtn1	UTSW	12	72217458	missense	possibly damaging	0.88
R4945:Rtn1	UTSW	12	72217484	missense	probably damaging	1.00
R6183:Rtn1	UTSW	12	72408491	missense	probably benign	0.09
R6493:Rtn1	UTSW	12	72308329	missense	probably damaging	0.99
R6547:Rtn1	UTSW	12	72308761	missense	possibly damaging	0.59
R6602:Rtn1	UTSW	12	72219318	missense	probably damaging	0.99
R7474:Rtn1	UTSW	12	72308390	missense	possibly damaging	0.87
R7615:Rtn1	UTSW	12	72304143	missense	probably damaging	1.00
R7697:Rtn1	UTSW	12	72408377	missense	probably benign	0.32
R7748:Rtn1	UTSW	12	72216926	missense	possibly damaging	0.53
R7754:Rtn1	UTSW	12	72308429	missense	probably damaging	0.96
R7834:Rtn1	UTSW	12	72304032	missense	probably damaging	0.99
R7970:Rtn1	UTSW	12	72308874	missense	probably benign	0.06
R8290:Rtn1	UTSW	12	72308419	missense	probably benign	0.07
R8311:Rtn1	UTSW	12	72304064	missense	probably damaging	1.00
R8440:Rtn1	UTSW	12	72223399	missense	probably damaging	1.00
Z1177:Rtn1	UTSW	12	72308864	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GGGCGGCTCATATATCCTAAG -3'
(R):5'- AGAATGCAGCTCTCTTGTCTG -3'

Sequencing Primer
(F):5'- GGCGGCTCATATATCCTAAGAGTAC -3'
(R):5'- GGGCCCCATTCAACGTTCTG -3'

Posted On

2014-06-30