Incidental Mutation 'R1892:Lgals3'
ID211646
Institutional Source Beutler Lab
Gene Symbol Lgals3
Ensembl Gene ENSMUSG00000050335
Gene Namelectin, galactose binding, soluble 3
Synonymsgal3, Mac-2, L-34, galectin-3
MMRRC Submission 039912-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1892 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47367751-47386160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 47384707 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 193 (N193K)
Ref Sequence ENSEMBL: ENSMUSP00000114350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043296] [ENSMUST00000142734] [ENSMUST00000144794] [ENSMUST00000146468] [ENSMUST00000150290] [ENSMUST00000151405] [ENSMUST00000180299] [ENSMUST00000226585]
Predicted Effect probably benign
Transcript: ENSMUST00000043296
SMART Domains Protein: ENSMUSP00000040416
Gene: ENSMUSG00000037544

DomainStartEndE-ValueType
coiled coil region 86 116 N/A INTRINSIC
Pfam:GKAP 327 590 2.2e-38 PFAM
low complexity region 735 757 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142734
AA Change: N193K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118169
Gene: ENSMUSG00000050335
AA Change: N193K

DomainStartEndE-ValueType
low complexity region 29 127 N/A INTRINSIC
GLECT 130 262 8.36e-57 SMART
Gal-bind_lectin 136 261 1.02e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144794
SMART Domains Protein: ENSMUSP00000114177
Gene: ENSMUSG00000050335

DomainStartEndE-ValueType
low complexity region 29 94 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146468
AA Change: N193K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119275
Gene: ENSMUSG00000050335
AA Change: N193K

DomainStartEndE-ValueType
low complexity region 29 127 N/A INTRINSIC
GLECT 130 262 8.36e-57 SMART
Gal-bind_lectin 136 261 1.02e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150290
AA Change: N193K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114350
Gene: ENSMUSG00000050335
AA Change: N193K

DomainStartEndE-ValueType
low complexity region 29 127 N/A INTRINSIC
GLECT 130 262 8.36e-57 SMART
Gal-bind_lectin 136 261 1.02e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151405
SMART Domains Protein: ENSMUSP00000118660
Gene: ENSMUSG00000050335

DomainStartEndE-ValueType
low complexity region 29 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177822
Predicted Effect probably benign
Transcript: ENSMUST00000180299
Predicted Effect probably benign
Transcript: ENSMUST00000226585
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin family of carbohydrate binding proteins. Members of this protein family have an affinity for beta-galactosides. The encoded protein is characterized by an N-terminal proline-rich tandem repeat domain and a single C-terminal carbohydrate recognition domain. This protein can self-associate through the N-terminal domain allowing it to bind to multivalent saccharide ligands. This protein localizes to the extracellular matrix, the cytoplasm and the nucleus. This protein plays a role in numerous cellular functions including apoptosis, innate immunity, cell adhesion and T-cell regulation. The protein exhibits antimicrobial activity against bacteria and fungi. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show susceptibility to S. pneumoniae infection, resistance to renal fibrosis, defects in chondrocyte differentiation, and impaired macrophage activation. Homozygotes for another null allele show altered peritoneal inflammation, and susceptibility to T. gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,216,338 A270T probably benign Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Adat3 T C 10: 80,606,415 L29P probably damaging Het
AI987944 A T 7: 41,374,596 C320S probably damaging Het
Asic4 C T 1: 75,469,482 R285W probably damaging Het
Asic5 A T 3: 82,020,986 I419L probably damaging Het
Batf A G 12: 85,689,328 K42E probably damaging Het
Bcar3 A G 3: 122,508,136 N160S probably benign Het
Bco2 C A 9: 50,550,563 G47V probably damaging Het
Bicc1 T G 10: 70,958,784 K181T probably damaging Het
Brinp2 A G 1: 158,254,972 probably null Het
Cacng8 A G 7: 3,415,052 D240G possibly damaging Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cdh1 A T 8: 106,664,250 K666I possibly damaging Het
Cdh16 A T 8: 104,617,999 I500N possibly damaging Het
Chst14 A G 2: 118,927,349 Y208C probably damaging Het
Chst9 T C 18: 15,452,960 H182R probably damaging Het
Clk2 A G 3: 89,175,195 I367M possibly damaging Het
Cobl G C 11: 12,253,258 S1066W probably damaging Het
Ctcfl A G 2: 173,118,685 V35A probably benign Het
Dchs1 G T 7: 105,764,156 H1151N probably benign Het
Dennd1c T C 17: 57,067,083 T529A probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Dync1h1 A G 12: 110,646,304 Y2871C probably damaging Het
Dytn T C 1: 63,677,261 E51G probably benign Het
Esd C T 14: 74,749,673 A266V probably damaging Het
Fam104a G T 11: 113,663,386 P161H probably damaging Het
Gli1 T C 10: 127,330,106 M1093V possibly damaging Het
Gm15446 A G 5: 109,943,387 K502E probably damaging Het
Gm15448 A C 7: 3,824,574 C195G probably benign Het
Gm4076 T A 13: 85,127,328 noncoding transcript Het
Gm9830 A G 9: 44,464,528 noncoding transcript Het
Gm9938 G A 19: 23,724,591 probably benign Het
Grhl1 G A 12: 24,584,910 R245H probably damaging Het
Hnrnpul1 A T 7: 25,726,766 D553E probably benign Het
Hpn G A 7: 31,099,043 Q415* probably null Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il1rl2 A G 1: 40,327,534 H76R probably damaging Het
Insrr G A 3: 87,813,877 V1112M probably damaging Het
Ints9 T C 14: 65,020,423 S351P probably benign Het
Itgav T A 2: 83,771,336 N350K probably damaging Het
Kdm4d C A 9: 14,464,317 V82L probably benign Het
Klc1 T C 12: 111,781,827 probably null Het
Kmt5c T A 7: 4,742,715 C69* probably null Het
Morc2b T A 17: 33,135,774 D1008V probably damaging Het
Mpg C T 11: 32,231,720 Q243* probably null Het
Muc15 C T 2: 110,737,352 R281* probably null Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nek5 A G 8: 22,107,729 M278T probably benign Het
Npas2 A G 1: 39,345,422 T599A probably benign Het
Nrf1 A G 6: 30,144,788 D519G probably null Het
Nup43 A G 10: 7,673,609 H176R probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr218 T C 1: 173,204,228 Y291H probably damaging Het
Olfr497 A T 7: 108,422,940 Y123F possibly damaging Het
Olfr790 A C 10: 129,501,033 I50L probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Pik3ip1 G T 11: 3,333,304 A135S probably damaging Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Prepl A G 17: 85,088,450 Y35H possibly damaging Het
Ptpn13 A G 5: 103,501,679 Y316C possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Ranbp2 T C 10: 58,464,099 V491A probably benign Het
Ranbp9 C A 13: 43,416,457 C495F possibly damaging Het
Rfx8 A T 1: 39,670,586 probably null Het
Rnf111 T A 9: 70,476,374 K92N probably damaging Het
Rtn1 A G 12: 72,212,563 I772T probably damaging Het
Ryr2 T A 13: 11,658,958 K72* probably null Het
Sergef A T 7: 46,614,616 probably null Het
Sez6l T C 5: 112,472,799 N305S probably damaging Het
Slc40a1 A T 1: 45,911,142 C383* probably null Het
Stab2 C T 10: 86,938,049 C806Y probably damaging Het
Stard9 A G 2: 120,693,708 T795A probably benign Het
Stk31 T C 6: 49,438,474 I536T probably damaging Het
Stox1 T A 10: 62,665,399 T461S possibly damaging Het
Suv39h2 T C 2: 3,459,768 Y219C probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Tbc1d2b T A 9: 90,218,943 I665F probably damaging Het
Tdrd6 T C 17: 43,624,805 N1784S probably benign Het
Tmem14c T C 13: 41,021,157 F81L possibly damaging Het
Tnrc6c A G 11: 117,714,362 N108D probably benign Het
Tox3 A T 8: 90,270,241 N131K probably benign Het
Tspear T A 10: 77,870,474 D359E probably benign Het
Ttc9 A G 12: 81,631,777 I125V probably benign Het
Ttn A T 2: 76,898,187 probably benign Het
Ubn2 C T 6: 38,491,291 S980F probably damaging Het
Zfp362 T A 4: 128,790,264 T30S probably benign Het
Zfp385c A C 11: 100,637,804 H32Q probably damaging Het
Zfp870 A T 17: 32,883,889 H156Q possibly damaging Het
Zfp873 T C 10: 82,061,246 C641R probably damaging Het
Zfp950 A T 19: 61,119,111 H511Q probably benign Het
Other mutations in Lgals3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lgals3 APN 14 47384718 missense probably benign 0.11
IGL02608:Lgals3 APN 14 47385601 missense probably benign 0.03
IGL02992:Lgals3 APN 14 47385525 missense probably benign 0.06
R4583:Lgals3 UTSW 14 47381687 splice site probably null
R4663:Lgals3 UTSW 14 47381622 synonymous probably null
Predicted Primers PCR Primer
(F):5'- CAGTTCCAACATGTTATGAAAGGG -3'
(R):5'- TCCTGAAGGAGCTGAAGGACAC -3'

Sequencing Primer
(F):5'- CCAACATGTTATGAAAGGGTTTGC -3'
(R):5'- TCAGCCCTAGCCTGTTGAG -3'
Posted On2014-06-30