Incidental Mutation 'R0123:Cd22'
ID21165
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene NameCD22 antigen
SynonymsLyb-8, Lyb8
MMRRC Submission 038408-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0123 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30865402-30880342 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 30867108 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000190646] [ENSMUST00000214289]
Predicted Effect probably benign
Transcript: ENSMUST00000019248
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108125
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186154
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect probably benign
Transcript: ENSMUST00000189718
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Predicted Effect probably benign
Transcript: ENSMUST00000190617
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190646
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214289
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,201 probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Becn1 A G 11: 101,290,498 Y326H probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1g T A 11: 94,409,476 H2156L probably damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Cmya5 A G 13: 93,095,904 L892P possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Cts8 T A 13: 61,253,577 M75L probably benign Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dlg5 T C 14: 24,147,206 M1558V probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Ell2 T C 13: 75,762,140 probably benign Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Nrxn1 A T 17: 90,995,487 probably null Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Upk1a A T 7: 30,612,394 I25N possibly damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp982 A T 4: 147,512,636 K150I probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zswim8 T C 14: 20,716,490 probably benign Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site probably null
crullers UTSW 7 30869883 missense probably damaging 1.00
gansu UTSW 7 30870105 missense probably damaging 1.00
lacrima UTSW 7 30876153 missense probably damaging 1.00
Lluvia UTSW 7 30870487 missense possibly damaging 0.48
Mist UTSW 7 30866658 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
well UTSW 7 30877787 nonsense probably null
Yosemite UTSW 7 30869509 critical splice donor site probably null
FR4304:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30869509 critical splice donor site probably null
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.07
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 missense probably benign 0.03
R2075:Cd22 UTSW 7 30869698 missense probably damaging 1.00
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R4796:Cd22 UTSW 7 30872956 synonymous probably null
R5179:Cd22 UTSW 7 30875874 missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5456:Cd22 UTSW 7 30876039 missense probably benign 0.02
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 unclassified probably benign
R5656:Cd22 UTSW 7 30869773 missense probably damaging 1.00
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
R6329:Cd22 UTSW 7 30877768 missense probably damaging 0.99
R6356:Cd22 UTSW 7 30877702 missense probably damaging 1.00
R6455:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R6550:Cd22 UTSW 7 30877552 missense probably benign 0.00
R6656:Cd22 UTSW 7 30877757 missense probably benign 0.11
R6688:Cd22 UTSW 7 30872964 missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30873431 splice site probably null
R6957:Cd22 UTSW 7 30867574 missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30878079 missense probably benign 0.03
R7083:Cd22 UTSW 7 30868048 missense probably damaging 0.99
R7225:Cd22 UTSW 7 30877634 missense not run
R7732:Cd22 UTSW 7 30870057 missense probably damaging 1.00
X0025:Cd22 UTSW 7 30873419 unclassified probably null
Z1176:Cd22 UTSW 7 30867963 missense probably benign 0.03
Z1176:Cd22 UTSW 7 30869530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCTGTGTGTCCCATGACCAG -3'
(R):5'- AACAGTGTGTCCTAGTCTGCCCTC -3'

Sequencing Primer
(F):5'- GTCCCATGACCAGCTCTCAG -3'
(R):5'- CTTGCTGCATGACAAGGTAAC -3'
Posted On2013-04-11