Incidental Mutation 'R1893:Pbx1'
ID211667
Institutional Source Beutler Lab
Gene Symbol Pbx1
Ensembl Gene ENSMUSG00000052534
Gene Namepre B cell leukemia homeobox 1
SynonymsPbx1b, Pbx1a, D230003C07Rik, Pbx-1, 2310056B04Rik
MMRRC Submission 039913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1893 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location168119364-168432270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 168203410 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 213 (M213K)
Ref Sequence ENSEMBL: ENSMUSP00000140606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064438] [ENSMUST00000072863] [ENSMUST00000176540] [ENSMUST00000176790] [ENSMUST00000188912]
Predicted Effect probably benign
Transcript: ENSMUST00000064438
AA Change: M213K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066385
Gene: ENSMUSG00000052534
AA Change: M213K

DomainStartEndE-ValueType
Pfam:PBC 35 232 2e-106 PFAM
HOX 233 290 5.15e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072863
AA Change: M213K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072640
Gene: ENSMUSG00000052534
AA Change: M213K

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176482
Predicted Effect possibly damaging
Transcript: ENSMUST00000176540
AA Change: M213K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135516
Gene: ENSMUSG00000052534
AA Change: M213K

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:PBC 40 232 6.9e-98 PFAM
HOX 233 298 6.17e-18 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176790
AA Change: M213K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134925
Gene: ENSMUSG00000052534
AA Change: M213K

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188912
AA Change: M213K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140606
Gene: ENSMUSG00000052534
AA Change: M213K

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Meta Mutation Damage Score 0.6122 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: This gene encodes a homeobox protein that belongs to the three-amino-acid loop extension/Pre-B cell leukemia transcription factor (TALE/PBX) family of proteins. The encoded protein is involved in several biological processes during embryogenesis including steroidogenesis, sexual development and the maintenance of hematopoietic stem cells. This protein functions in the development of several organ systems and plays a role in skeletal patterning and programming. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous disruption of this gene causes late gestational death, hypoplasia/aplasia of many organs, impaired hematopoiesis, anemia, skin edema, axial and appendicular skeleton defects, absent adrenal glands, abnormal chondrocyte differentiation, and abnormal bone, kidney and pancreas development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,809 Y674H possibly damaging Het
Aars2 G A 17: 45,514,799 R347Q probably benign Het
Abca15 A T 7: 120,340,553 M293L possibly damaging Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Aldh1l2 G T 10: 83,492,536 N772K probably damaging Het
Ascc2 T A 11: 4,672,305 L457Q probably benign Het
Aspm T A 1: 139,479,867 I2164N probably damaging Het
Cabs1 A G 5: 87,980,035 T182A probably benign Het
Carmil1 T C 13: 24,024,463 E833G possibly damaging Het
Ccdc102a G A 8: 94,913,543 T41M probably damaging Het
Clec2h T C 6: 128,670,832 V48A probably benign Het
Cpb2 G A 14: 75,255,963 V27I probably benign Het
Cr2 T C 1: 195,155,187 H1201R probably benign Het
Cyp2d9 T C 15: 82,452,606 V52A probably damaging Het
Cyp4a12a C A 4: 115,326,667 N223K probably benign Het
Cyp7b1 G A 3: 18,096,567 S336L possibly damaging Het
D230025D16Rik G T 8: 105,246,501 V248F probably damaging Het
Dnah10 T C 5: 124,754,317 V803A probably benign Het
Dnah17 T A 11: 118,066,968 T2745S probably benign Het
E330021D16Rik A G 6: 136,401,827 S2P possibly damaging Het
Ep300 T A 15: 81,631,646 probably benign Het
Epha3 A G 16: 63,568,399 S829P probably damaging Het
Fads3 C A 19: 10,056,504 H418N probably benign Het
Fat1 T C 8: 45,023,856 S1980P probably damaging Het
Fgf20 T C 8: 40,279,803 E198G possibly damaging Het
Fgl2 G A 5: 21,375,671 R337H probably benign Het
Gbp2 G T 3: 142,630,172 probably benign Het
Gja10 G A 4: 32,601,541 S281L probably benign Het
Gm5422 G A 10: 31,249,613 noncoding transcript Het
Gmpr T A 13: 45,520,947 D129E possibly damaging Het
Gtf3c4 C T 2: 28,834,362 V453I possibly damaging Het
Heatr6 T C 11: 83,757,314 V111A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hpn T A 7: 31,099,348 D103V probably damaging Het
Ipcef1 G A 10: 6,900,680 R304W probably damaging Het
Iqcb1 A G 16: 36,831,883 D52G probably damaging Het
Klhdc7b C T 15: 89,387,695 probably null Het
Klhl1 A T 14: 96,240,206 probably null Het
Lrrn1 A T 6: 107,568,122 I294F possibly damaging Het
Map3k1 A T 13: 111,768,033 F406I possibly damaging Het
Map4k4 T A 1: 40,001,557 V579E probably benign Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mdga1 A T 17: 29,849,226 Y305N probably damaging Het
Mgl2 T A 11: 70,134,167 probably null Het
Mnx1 C T 5: 29,477,830 G149D unknown Het
Mtbp T A 15: 55,557,668 S17T probably benign Het
Neu3 T C 7: 99,823,420 T37A possibly damaging Het
Nr1i3 T C 1: 171,217,223 probably null Het
Odf3l1 A G 9: 56,849,214 Y173H probably benign Het
Olfr118 A T 17: 37,672,856 K278* probably null Het
Olfr466 T A 13: 65,152,992 M256K possibly damaging Het
Olfr522 T C 7: 140,162,821 N43S probably damaging Het
Olfr981 A T 9: 40,022,974 I194F possibly damaging Het
Osr2 A G 15: 35,300,462 T55A possibly damaging Het
Palld A G 8: 61,516,621 V981A probably damaging Het
Pcdhb12 C A 18: 37,437,083 H427Q probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Polm T C 11: 5,835,574 T162A possibly damaging Het
Prox1 A G 1: 190,160,518 probably benign Het
Ptpn7 A T 1: 135,134,903 T127S probably benign Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rab21 T C 10: 115,290,900 T181A probably benign Het
Rab38 A T 7: 88,490,716 T198S probably benign Het
Rnase4 C G 14: 51,104,938 Q40E possibly damaging Het
Rnf213 T A 11: 119,416,448 W645R probably damaging Het
Rnf8 A G 17: 29,621,550 I51M probably damaging Het
Sbpl T A 17: 23,953,267 D226V unknown Het
Sdf4 T G 4: 156,000,748 I180S probably benign Het
Simc1 A G 13: 54,539,715 K99R probably damaging Het
Slc2a4 T C 11: 69,946,572 Q49R probably damaging Het
Slco1a4 T C 6: 141,834,616 probably null Het
Slco5a1 C A 1: 12,894,472 C527F probably damaging Het
Sox6 T A 7: 115,544,568 N405I probably benign Het
Sphkap G A 1: 83,278,966 P354L probably benign Het
Spi1 A G 2: 91,114,357 D149G probably benign Het
Sptan1 T A 2: 30,020,460 D1812E probably damaging Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Sult2a6 T C 7: 14,225,889 T240A probably benign Het
Tacc2 A G 7: 130,625,325 S1247G probably benign Het
Taf4 T C 2: 179,933,030 D594G probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Ticam1 T C 17: 56,271,894 N67S probably benign Het
Tlr6 A G 5: 64,953,213 F784L probably damaging Het
Tmprss15 A G 16: 79,071,418 V202A probably benign Het
Trp53bp2 T C 1: 182,431,628 V82A probably benign Het
Ube2o C T 11: 116,548,835 V170I possibly damaging Het
Vmn1r177 G A 7: 23,866,148 T101I probably benign Het
Vmn2r68 A T 7: 85,234,659 Y79* probably null Het
Wdr35 A C 12: 8,985,994 Y255S probably benign Het
Zfp507 A T 7: 35,802,627 probably benign Het
Zfp688 G A 7: 127,419,237 R239C probably damaging Het
Zfp74 T A 7: 29,936,045 probably null Het
Zfp932 A G 5: 110,009,203 N223D possibly damaging Het
Other mutations in Pbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Pbx1 APN 1 168191304 missense probably benign 0.00
IGL02256:Pbx1 APN 1 168183602 missense possibly damaging 0.88
IGL03040:Pbx1 APN 1 168427946 splice site probably benign
root_cause UTSW 1 168209534 missense probably damaging 1.00
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0947:Pbx1 UTSW 1 168203366 missense probably damaging 1.00
R1785:Pbx1 UTSW 1 168431378 missense probably benign 0.09
R3552:Pbx1 UTSW 1 168158793 missense possibly damaging 0.88
R4176:Pbx1 UTSW 1 168191272 splice site probably null
R4757:Pbx1 UTSW 1 168195881 missense probably damaging 1.00
R5024:Pbx1 UTSW 1 168183589 missense possibly damaging 0.93
R6102:Pbx1 UTSW 1 168183565 missense probably benign 0.05
R6296:Pbx1 UTSW 1 168183615 missense possibly damaging 0.71
R6302:Pbx1 UTSW 1 168191341 missense probably benign
R6488:Pbx1 UTSW 1 168191395 missense probably damaging 1.00
R6501:Pbx1 UTSW 1 168209534 missense probably damaging 1.00
R7014:Pbx1 UTSW 1 168431380 missense probably damaging 0.98
R7070:Pbx1 UTSW 1 168195768 missense probably damaging 0.98
R7677:Pbx1 UTSW 1 168203426 missense probably damaging 0.99
R7898:Pbx1 UTSW 1 168185047 missense probably benign 0.12
X0024:Pbx1 UTSW 1 168431365 nonsense probably null
X0027:Pbx1 UTSW 1 168183612 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTGTTTCTCGGACCTTAGACC -3'
(R):5'- AGCCAGATATTTCAGTTCACCCC -3'

Sequencing Primer
(F):5'- TTAGACCTTCACACAAGCTAGTG -3'
(R):5'- CATGTTTACCGTGTTACCACTGCAG -3'
Posted On2014-06-30