Incidental Mutation 'R1893:Trp53bp2'
ID211669
Institutional Source Beutler Lab
Gene Symbol Trp53bp2
Ensembl Gene ENSMUSG00000026510
Gene Nametransformation related protein 53 binding protein 2
Synonyms53BP2, ASPP2
MMRRC Submission 039913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1893 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location182409172-182462432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 182431628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 82 (V82A)
Ref Sequence ENSEMBL: ENSMUSP00000112508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117245]
Predicted Effect probably benign
Transcript: ENSMUST00000117245
AA Change: V82A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112508
Gene: ENSMUSG00000026510
AA Change: V82A

DomainStartEndE-ValueType
PDB:2UWQ|A 4 89 1e-53 PDB
Blast:RA 10 91 7e-50 BLAST
coiled coil region 129 306 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
low complexity region 495 512 N/A INTRINSIC
PDB:4IRV|H 728 788 5e-25 PDB
low complexity region 865 890 N/A INTRINSIC
ANK 964 993 2.52e-6 SMART
ANK 997 1026 7.13e-6 SMART
SH3 1066 1124 6.2e-13 SMART
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation is lethal by 30 days of age, although majority die embryonically. Heterozygotes show increased susceptibility to spontaneous and induced tumors of the lymphoma and sarcoma types [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,809 Y674H possibly damaging Het
Aars2 G A 17: 45,514,799 R347Q probably benign Het
Abca15 A T 7: 120,340,553 M293L possibly damaging Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Aldh1l2 G T 10: 83,492,536 N772K probably damaging Het
Ascc2 T A 11: 4,672,305 L457Q probably benign Het
Aspm T A 1: 139,479,867 I2164N probably damaging Het
Cabs1 A G 5: 87,980,035 T182A probably benign Het
Carmil1 T C 13: 24,024,463 E833G possibly damaging Het
Ccdc102a G A 8: 94,913,543 T41M probably damaging Het
Clec2h T C 6: 128,670,832 V48A probably benign Het
Cpb2 G A 14: 75,255,963 V27I probably benign Het
Cr2 T C 1: 195,155,187 H1201R probably benign Het
Cyp2d9 T C 15: 82,452,606 V52A probably damaging Het
Cyp4a12a C A 4: 115,326,667 N223K probably benign Het
Cyp7b1 G A 3: 18,096,567 S336L possibly damaging Het
D230025D16Rik G T 8: 105,246,501 V248F probably damaging Het
Dnah10 T C 5: 124,754,317 V803A probably benign Het
Dnah17 T A 11: 118,066,968 T2745S probably benign Het
E330021D16Rik A G 6: 136,401,827 S2P possibly damaging Het
Ep300 T A 15: 81,631,646 probably benign Het
Epha3 A G 16: 63,568,399 S829P probably damaging Het
Fads3 C A 19: 10,056,504 H418N probably benign Het
Fat1 T C 8: 45,023,856 S1980P probably damaging Het
Fgf20 T C 8: 40,279,803 E198G possibly damaging Het
Fgl2 G A 5: 21,375,671 R337H probably benign Het
Gbp2 G T 3: 142,630,172 probably benign Het
Gja10 G A 4: 32,601,541 S281L probably benign Het
Gm5422 G A 10: 31,249,613 noncoding transcript Het
Gmpr T A 13: 45,520,947 D129E possibly damaging Het
Gtf3c4 C T 2: 28,834,362 V453I possibly damaging Het
Heatr6 T C 11: 83,757,314 V111A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hpn T A 7: 31,099,348 D103V probably damaging Het
Ipcef1 G A 10: 6,900,680 R304W probably damaging Het
Iqcb1 A G 16: 36,831,883 D52G probably damaging Het
Klhdc7b C T 15: 89,387,695 probably null Het
Klhl1 A T 14: 96,240,206 probably null Het
Lrrn1 A T 6: 107,568,122 I294F possibly damaging Het
Map3k1 A T 13: 111,768,033 F406I possibly damaging Het
Map4k4 T A 1: 40,001,557 V579E probably benign Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mdga1 A T 17: 29,849,226 Y305N probably damaging Het
Mgl2 T A 11: 70,134,167 probably null Het
Mnx1 C T 5: 29,477,830 G149D unknown Het
Mtbp T A 15: 55,557,668 S17T probably benign Het
Neu3 T C 7: 99,823,420 T37A possibly damaging Het
Nr1i3 T C 1: 171,217,223 probably null Het
Odf3l1 A G 9: 56,849,214 Y173H probably benign Het
Olfr118 A T 17: 37,672,856 K278* probably null Het
Olfr466 T A 13: 65,152,992 M256K possibly damaging Het
Olfr522 T C 7: 140,162,821 N43S probably damaging Het
Olfr981 A T 9: 40,022,974 I194F possibly damaging Het
Osr2 A G 15: 35,300,462 T55A possibly damaging Het
Palld A G 8: 61,516,621 V981A probably damaging Het
Pbx1 A T 1: 168,203,410 M213K possibly damaging Het
Pcdhb12 C A 18: 37,437,083 H427Q probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Polm T C 11: 5,835,574 T162A possibly damaging Het
Prox1 A G 1: 190,160,518 probably benign Het
Ptpn7 A T 1: 135,134,903 T127S probably benign Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rab21 T C 10: 115,290,900 T181A probably benign Het
Rab38 A T 7: 88,490,716 T198S probably benign Het
Rnase4 C G 14: 51,104,938 Q40E possibly damaging Het
Rnf213 T A 11: 119,416,448 W645R probably damaging Het
Rnf8 A G 17: 29,621,550 I51M probably damaging Het
Sbpl T A 17: 23,953,267 D226V unknown Het
Sdf4 T G 4: 156,000,748 I180S probably benign Het
Simc1 A G 13: 54,539,715 K99R probably damaging Het
Slc2a4 T C 11: 69,946,572 Q49R probably damaging Het
Slco1a4 T C 6: 141,834,616 probably null Het
Slco5a1 C A 1: 12,894,472 C527F probably damaging Het
Sox6 T A 7: 115,544,568 N405I probably benign Het
Sphkap G A 1: 83,278,966 P354L probably benign Het
Spi1 A G 2: 91,114,357 D149G probably benign Het
Sptan1 T A 2: 30,020,460 D1812E probably damaging Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Sult2a6 T C 7: 14,225,889 T240A probably benign Het
Tacc2 A G 7: 130,625,325 S1247G probably benign Het
Taf4 T C 2: 179,933,030 D594G probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Ticam1 T C 17: 56,271,894 N67S probably benign Het
Tlr6 A G 5: 64,953,213 F784L probably damaging Het
Tmprss15 A G 16: 79,071,418 V202A probably benign Het
Ube2o C T 11: 116,548,835 V170I possibly damaging Het
Vmn1r177 G A 7: 23,866,148 T101I probably benign Het
Vmn2r68 A T 7: 85,234,659 Y79* probably null Het
Wdr35 A C 12: 8,985,994 Y255S probably benign Het
Zfp507 A T 7: 35,802,627 probably benign Het
Zfp688 G A 7: 127,419,237 R239C probably damaging Het
Zfp74 T A 7: 29,936,045 probably null Het
Zfp932 A G 5: 110,009,203 N223D possibly damaging Het
Other mutations in Trp53bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Trp53bp2 APN 1 182440976 missense probably benign 0.17
IGL00920:Trp53bp2 APN 1 182444654 unclassified probably benign
IGL01336:Trp53bp2 APN 1 182431583 missense probably damaging 1.00
IGL01760:Trp53bp2 APN 1 182448428 missense possibly damaging 0.68
IGL02539:Trp53bp2 APN 1 182448691 missense probably damaging 0.99
IGL02609:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02720:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02962:Trp53bp2 APN 1 182431595 missense probably benign 0.00
IGL03348:Trp53bp2 APN 1 182453748 missense probably damaging 1.00
Nosa UTSW 1 182455740 missense probably damaging 1.00
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0347:Trp53bp2 UTSW 1 182441648 missense probably benign 0.08
R1422:Trp53bp2 UTSW 1 182446464 missense probably benign
R1833:Trp53bp2 UTSW 1 182429016 missense probably damaging 0.98
R1845:Trp53bp2 UTSW 1 182458903 missense probably damaging 1.00
R1927:Trp53bp2 UTSW 1 182452664 missense probably damaging 0.98
R2017:Trp53bp2 UTSW 1 182449015 missense probably benign
R2020:Trp53bp2 UTSW 1 182442819 missense probably damaging 1.00
R2072:Trp53bp2 UTSW 1 182458867 missense probably benign 0.00
R2120:Trp53bp2 UTSW 1 182441639 missense probably benign 0.06
R2504:Trp53bp2 UTSW 1 182441639 missense probably benign 0.26
R2970:Trp53bp2 UTSW 1 182431598 missense probably damaging 1.00
R3051:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3052:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3053:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3151:Trp53bp2 UTSW 1 182428960 missense probably damaging 1.00
R4043:Trp53bp2 UTSW 1 182449061 missense possibly damaging 0.93
R4757:Trp53bp2 UTSW 1 182458774 missense probably benign 0.04
R4785:Trp53bp2 UTSW 1 182448997 missense probably benign
R4817:Trp53bp2 UTSW 1 182441805 critical splice donor site probably null
R4836:Trp53bp2 UTSW 1 182431582 missense probably damaging 1.00
R5040:Trp53bp2 UTSW 1 182444706 missense probably damaging 1.00
R5882:Trp53bp2 UTSW 1 182442212 missense possibly damaging 0.87
R6007:Trp53bp2 UTSW 1 182455740 missense probably damaging 1.00
R6356:Trp53bp2 UTSW 1 182448997 missense probably benign
R6886:Trp53bp2 UTSW 1 182429043 critical splice donor site probably null
R6987:Trp53bp2 UTSW 1 182446635 missense probably damaging 0.99
R7026:Trp53bp2 UTSW 1 182442735 missense probably benign
R7141:Trp53bp2 UTSW 1 182448508 missense
R7363:Trp53bp2 UTSW 1 182444666 missense probably damaging 0.99
R7452:Trp53bp2 UTSW 1 182446568 nonsense probably null
R7816:Trp53bp2 UTSW 1 182448695 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCTTTATACTGACTTGACACTG -3'
(R):5'- GCTGTTGCTCTAATGTCCTAGC -3'

Sequencing Primer
(F):5'- GTCAATATTTTGAGTTCTGTTGATGG -3'
(R):5'- GTTGCTCTAATGTCCTAGCTTCCC -3'
Posted On2014-06-30