Incidental Mutation 'R1893:Slco1a4'
ID211694
Institutional Source Beutler Lab
Gene Symbol Slco1a4
Ensembl Gene ENSMUSG00000030237
Gene Namesolute carrier organic anion transporter family, member 1a4
SynonymsOatp2, Oatp1a4, Slc21a5
MMRRC Submission 039913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1893 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location141805440-141856199 bp(-) (GRCm38)
Type of Mutationsplice site (28 bp from exon)
DNA Base Change (assembly) T to C at 141834616 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032364] [ENSMUST00000163678] [ENSMUST00000165990]
Predicted Effect probably benign
Transcript: ENSMUST00000032364
SMART Domains Protein: ENSMUSP00000032364
Gene: ENSMUSG00000030237

DomainStartEndE-ValueType
Pfam:OATP 19 598 3.2e-196 PFAM
Pfam:MFS_1 22 421 9.2e-27 PFAM
Pfam:Kazal_2 445 486 5e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163678
SMART Domains Protein: ENSMUSP00000126767
Gene: ENSMUSG00000030237

DomainStartEndE-ValueType
Pfam:OATP 19 139 1.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165990
SMART Domains Protein: ENSMUSP00000130746
Gene: ENSMUSG00000030237

DomainStartEndE-ValueType
Pfam:OATP 21 597 3.2e-164 PFAM
Pfam:MFS_1 22 421 7.2e-27 PFAM
Pfam:Kazal_2 445 486 6.8e-11 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 99% (99/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,809 Y674H possibly damaging Het
Aars2 G A 17: 45,514,799 R347Q probably benign Het
Abca15 A T 7: 120,340,553 M293L possibly damaging Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Aldh1l2 G T 10: 83,492,536 N772K probably damaging Het
Ascc2 T A 11: 4,672,305 L457Q probably benign Het
Aspm T A 1: 139,479,867 I2164N probably damaging Het
Cabs1 A G 5: 87,980,035 T182A probably benign Het
Carmil1 T C 13: 24,024,463 E833G possibly damaging Het
Ccdc102a G A 8: 94,913,543 T41M probably damaging Het
Clec2h T C 6: 128,670,832 V48A probably benign Het
Cpb2 G A 14: 75,255,963 V27I probably benign Het
Cr2 T C 1: 195,155,187 H1201R probably benign Het
Cyp2d9 T C 15: 82,452,606 V52A probably damaging Het
Cyp4a12a C A 4: 115,326,667 N223K probably benign Het
Cyp7b1 G A 3: 18,096,567 S336L possibly damaging Het
D230025D16Rik G T 8: 105,246,501 V248F probably damaging Het
Dnah10 T C 5: 124,754,317 V803A probably benign Het
Dnah17 T A 11: 118,066,968 T2745S probably benign Het
E330021D16Rik A G 6: 136,401,827 S2P possibly damaging Het
Ep300 T A 15: 81,631,646 probably benign Het
Epha3 A G 16: 63,568,399 S829P probably damaging Het
Fads3 C A 19: 10,056,504 H418N probably benign Het
Fat1 T C 8: 45,023,856 S1980P probably damaging Het
Fgf20 T C 8: 40,279,803 E198G possibly damaging Het
Fgl2 G A 5: 21,375,671 R337H probably benign Het
Gbp2 G T 3: 142,630,172 probably benign Het
Gja10 G A 4: 32,601,541 S281L probably benign Het
Gm5422 G A 10: 31,249,613 noncoding transcript Het
Gmpr T A 13: 45,520,947 D129E possibly damaging Het
Gtf3c4 C T 2: 28,834,362 V453I possibly damaging Het
Heatr6 T C 11: 83,757,314 V111A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hpn T A 7: 31,099,348 D103V probably damaging Het
Ipcef1 G A 10: 6,900,680 R304W probably damaging Het
Iqcb1 A G 16: 36,831,883 D52G probably damaging Het
Klhdc7b C T 15: 89,387,695 probably null Het
Klhl1 A T 14: 96,240,206 probably null Het
Lrrn1 A T 6: 107,568,122 I294F possibly damaging Het
Map3k1 A T 13: 111,768,033 F406I possibly damaging Het
Map4k4 T A 1: 40,001,557 V579E probably benign Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mdga1 A T 17: 29,849,226 Y305N probably damaging Het
Mgl2 T A 11: 70,134,167 probably null Het
Mnx1 C T 5: 29,477,830 G149D unknown Het
Mtbp T A 15: 55,557,668 S17T probably benign Het
Neu3 T C 7: 99,823,420 T37A possibly damaging Het
Nr1i3 T C 1: 171,217,223 probably null Het
Odf3l1 A G 9: 56,849,214 Y173H probably benign Het
Olfr118 A T 17: 37,672,856 K278* probably null Het
Olfr466 T A 13: 65,152,992 M256K possibly damaging Het
Olfr522 T C 7: 140,162,821 N43S probably damaging Het
Olfr981 A T 9: 40,022,974 I194F possibly damaging Het
Osr2 A G 15: 35,300,462 T55A possibly damaging Het
Palld A G 8: 61,516,621 V981A probably damaging Het
Pbx1 A T 1: 168,203,410 M213K possibly damaging Het
Pcdhb12 C A 18: 37,437,083 H427Q probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Polm T C 11: 5,835,574 T162A possibly damaging Het
Prox1 A G 1: 190,160,518 probably benign Het
Ptpn7 A T 1: 135,134,903 T127S probably benign Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rab21 T C 10: 115,290,900 T181A probably benign Het
Rab38 A T 7: 88,490,716 T198S probably benign Het
Rnase4 C G 14: 51,104,938 Q40E possibly damaging Het
Rnf213 T A 11: 119,416,448 W645R probably damaging Het
Rnf8 A G 17: 29,621,550 I51M probably damaging Het
Sbpl T A 17: 23,953,267 D226V unknown Het
Sdf4 T G 4: 156,000,748 I180S probably benign Het
Simc1 A G 13: 54,539,715 K99R probably damaging Het
Slc2a4 T C 11: 69,946,572 Q49R probably damaging Het
Slco5a1 C A 1: 12,894,472 C527F probably damaging Het
Sox6 T A 7: 115,544,568 N405I probably benign Het
Sphkap G A 1: 83,278,966 P354L probably benign Het
Spi1 A G 2: 91,114,357 D149G probably benign Het
Sptan1 T A 2: 30,020,460 D1812E probably damaging Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Sult2a6 T C 7: 14,225,889 T240A probably benign Het
Tacc2 A G 7: 130,625,325 S1247G probably benign Het
Taf4 T C 2: 179,933,030 D594G probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Ticam1 T C 17: 56,271,894 N67S probably benign Het
Tlr6 A G 5: 64,953,213 F784L probably damaging Het
Tmprss15 A G 16: 79,071,418 V202A probably benign Het
Trp53bp2 T C 1: 182,431,628 V82A probably benign Het
Ube2o C T 11: 116,548,835 V170I possibly damaging Het
Vmn1r177 G A 7: 23,866,148 T101I probably benign Het
Vmn2r68 A T 7: 85,234,659 Y79* probably null Het
Wdr35 A C 12: 8,985,994 Y255S probably benign Het
Zfp507 A T 7: 35,802,627 probably benign Het
Zfp688 G A 7: 127,419,237 R239C probably damaging Het
Zfp74 T A 7: 29,936,045 probably null Het
Zfp932 A G 5: 110,009,203 N223D possibly damaging Het
Other mutations in Slco1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Slco1a4 APN 6 141807182 critical splice acceptor site probably null
IGL01573:Slco1a4 APN 6 141812851 splice site probably benign
IGL01735:Slco1a4 APN 6 141817751 missense probably benign 0.00
IGL03115:Slco1a4 APN 6 141819603 missense probably benign 0.05
IGL03115:Slco1a4 APN 6 141817859 missense probably damaging 1.00
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0305:Slco1a4 UTSW 6 141817753 missense possibly damaging 0.47
R0511:Slco1a4 UTSW 6 141830860 splice site probably benign
R0660:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R0664:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R1589:Slco1a4 UTSW 6 141845447 missense probably benign
R1606:Slco1a4 UTSW 6 141839611 missense probably damaging 1.00
R1665:Slco1a4 UTSW 6 141839577 missense possibly damaging 0.79
R1742:Slco1a4 UTSW 6 141825045 missense probably benign 0.07
R1763:Slco1a4 UTSW 6 141812731 missense probably benign 0.26
R1908:Slco1a4 UTSW 6 141815447 critical splice donor site probably null
R1944:Slco1a4 UTSW 6 141839550 missense probably benign 0.00
R2144:Slco1a4 UTSW 6 141809378 missense probably damaging 1.00
R2276:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.49
R2340:Slco1a4 UTSW 6 141841377 missense probably benign 0.00
R3017:Slco1a4 UTSW 6 141812670 splice site probably null
R3769:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R4577:Slco1a4 UTSW 6 141819540 missense probably damaging 0.97
R4650:Slco1a4 UTSW 6 141812698 missense possibly damaging 0.94
R4801:Slco1a4 UTSW 6 141845497 start gained probably benign
R4802:Slco1a4 UTSW 6 141845497 start gained probably benign
R4896:Slco1a4 UTSW 6 141815505 missense possibly damaging 0.91
R5126:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.94
R5183:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R5399:Slco1a4 UTSW 6 141830707 missense probably damaging 0.98
R5645:Slco1a4 UTSW 6 141834659 missense possibly damaging 0.95
R5650:Slco1a4 UTSW 6 141809394 missense possibly damaging 0.69
R5832:Slco1a4 UTSW 6 141819544 missense probably benign 0.00
R6180:Slco1a4 UTSW 6 141817820 missense possibly damaging 0.95
R6415:Slco1a4 UTSW 6 141834689 nonsense probably null
R6992:Slco1a4 UTSW 6 141819604 missense probably benign 0.05
R7024:Slco1a4 UTSW 6 141834708 missense probably benign 0.00
R7696:Slco1a4 UTSW 6 141810511 nonsense probably null
R7751:Slco1a4 UTSW 6 141834687 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TATATTCAGACTCAGGAGGGAGAGC -3'
(R):5'- TCTAGCTTGCCACGACATAGG -3'

Sequencing Primer
(F):5'- GCATGCTAGATTATTAGACATCTCCC -3'
(R):5'- CAACTTGTCTTCAGGAAAGCAG -3'
Posted On2014-06-30