Incidental Mutation 'R1893:Tacc2'
ID211706
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 039913-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1893 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130625325 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1247 (S1247G)
Ref Sequence ENSEMBL: ENSMUSP00000081561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]
Predicted Effect probably benign
Transcript: ENSMUST00000059145
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084513
AA Change: S1247G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: S1247G

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect unknown
Transcript: ENSMUST00000207918
AA Change: S1247G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207999
Predicted Effect probably benign
Transcript: ENSMUST00000208722
Predicted Effect unknown
Transcript: ENSMUST00000215492
AA Change: S1266G
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,809 Y674H possibly damaging Het
Aars2 G A 17: 45,514,799 R347Q probably benign Het
Abca15 A T 7: 120,340,553 M293L possibly damaging Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Aldh1l2 G T 10: 83,492,536 N772K probably damaging Het
Ascc2 T A 11: 4,672,305 L457Q probably benign Het
Aspm T A 1: 139,479,867 I2164N probably damaging Het
Cabs1 A G 5: 87,980,035 T182A probably benign Het
Carmil1 T C 13: 24,024,463 E833G possibly damaging Het
Ccdc102a G A 8: 94,913,543 T41M probably damaging Het
Clec2h T C 6: 128,670,832 V48A probably benign Het
Cpb2 G A 14: 75,255,963 V27I probably benign Het
Cr2 T C 1: 195,155,187 H1201R probably benign Het
Cyp2d9 T C 15: 82,452,606 V52A probably damaging Het
Cyp4a12a C A 4: 115,326,667 N223K probably benign Het
Cyp7b1 G A 3: 18,096,567 S336L possibly damaging Het
D230025D16Rik G T 8: 105,246,501 V248F probably damaging Het
Dnah10 T C 5: 124,754,317 V803A probably benign Het
Dnah17 T A 11: 118,066,968 T2745S probably benign Het
E330021D16Rik A G 6: 136,401,827 S2P possibly damaging Het
Ep300 T A 15: 81,631,646 probably benign Het
Epha3 A G 16: 63,568,399 S829P probably damaging Het
Fads3 C A 19: 10,056,504 H418N probably benign Het
Fat1 T C 8: 45,023,856 S1980P probably damaging Het
Fgf20 T C 8: 40,279,803 E198G possibly damaging Het
Fgl2 G A 5: 21,375,671 R337H probably benign Het
Gbp2 G T 3: 142,630,172 probably benign Het
Gja10 G A 4: 32,601,541 S281L probably benign Het
Gm5422 G A 10: 31,249,613 noncoding transcript Het
Gmpr T A 13: 45,520,947 D129E possibly damaging Het
Gtf3c4 C T 2: 28,834,362 V453I possibly damaging Het
Heatr6 T C 11: 83,757,314 V111A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hpn T A 7: 31,099,348 D103V probably damaging Het
Ipcef1 G A 10: 6,900,680 R304W probably damaging Het
Iqcb1 A G 16: 36,831,883 D52G probably damaging Het
Klhdc7b C T 15: 89,387,695 probably null Het
Klhl1 A T 14: 96,240,206 probably null Het
Lrrn1 A T 6: 107,568,122 I294F possibly damaging Het
Map3k1 A T 13: 111,768,033 F406I possibly damaging Het
Map4k4 T A 1: 40,001,557 V579E probably benign Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mdga1 A T 17: 29,849,226 Y305N probably damaging Het
Mgl2 T A 11: 70,134,167 probably null Het
Mnx1 C T 5: 29,477,830 G149D unknown Het
Mtbp T A 15: 55,557,668 S17T probably benign Het
Neu3 T C 7: 99,823,420 T37A possibly damaging Het
Nr1i3 T C 1: 171,217,223 probably null Het
Odf3l1 A G 9: 56,849,214 Y173H probably benign Het
Olfr118 A T 17: 37,672,856 K278* probably null Het
Olfr466 T A 13: 65,152,992 M256K possibly damaging Het
Olfr522 T C 7: 140,162,821 N43S probably damaging Het
Olfr981 A T 9: 40,022,974 I194F possibly damaging Het
Osr2 A G 15: 35,300,462 T55A possibly damaging Het
Palld A G 8: 61,516,621 V981A probably damaging Het
Pbx1 A T 1: 168,203,410 M213K possibly damaging Het
Pcdhb12 C A 18: 37,437,083 H427Q probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Polm T C 11: 5,835,574 T162A possibly damaging Het
Prox1 A G 1: 190,160,518 probably benign Het
Ptpn7 A T 1: 135,134,903 T127S probably benign Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rab21 T C 10: 115,290,900 T181A probably benign Het
Rab38 A T 7: 88,490,716 T198S probably benign Het
Rnase4 C G 14: 51,104,938 Q40E possibly damaging Het
Rnf213 T A 11: 119,416,448 W645R probably damaging Het
Rnf8 A G 17: 29,621,550 I51M probably damaging Het
Sbpl T A 17: 23,953,267 D226V unknown Het
Sdf4 T G 4: 156,000,748 I180S probably benign Het
Simc1 A G 13: 54,539,715 K99R probably damaging Het
Slc2a4 T C 11: 69,946,572 Q49R probably damaging Het
Slco1a4 T C 6: 141,834,616 probably null Het
Slco5a1 C A 1: 12,894,472 C527F probably damaging Het
Sox6 T A 7: 115,544,568 N405I probably benign Het
Sphkap G A 1: 83,278,966 P354L probably benign Het
Spi1 A G 2: 91,114,357 D149G probably benign Het
Sptan1 T A 2: 30,020,460 D1812E probably damaging Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Sult2a6 T C 7: 14,225,889 T240A probably benign Het
Taf4 T C 2: 179,933,030 D594G probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Ticam1 T C 17: 56,271,894 N67S probably benign Het
Tlr6 A G 5: 64,953,213 F784L probably damaging Het
Tmprss15 A G 16: 79,071,418 V202A probably benign Het
Trp53bp2 T C 1: 182,431,628 V82A probably benign Het
Ube2o C T 11: 116,548,835 V170I possibly damaging Het
Vmn1r177 G A 7: 23,866,148 T101I probably benign Het
Vmn2r68 A T 7: 85,234,659 Y79* probably null Het
Wdr35 A C 12: 8,985,994 Y255S probably benign Het
Zfp507 A T 7: 35,802,627 probably benign Het
Zfp688 G A 7: 127,419,237 R239C probably damaging Het
Zfp74 T A 7: 29,936,045 probably null Het
Zfp932 A G 5: 110,009,203 N223D possibly damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
aces UTSW 7 130733528 missense probably damaging 1.00
Jacks UTSW 7 130625764 missense probably damaging 0.98
kings UTSW 7 130623483 missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
R7111:Tacc2 UTSW 7 130728888 missense probably benign 0.16
R7150:Tacc2 UTSW 7 130729077 missense probably benign
R7290:Tacc2 UTSW 7 130729373 missense probably benign 0.07
R7404:Tacc2 UTSW 7 130623336 missense probably benign 0.22
R7460:Tacc2 UTSW 7 130624633 missense probably benign 0.39
R7651:Tacc2 UTSW 7 130623154 missense probably benign 0.25
R7666:Tacc2 UTSW 7 130716814 start gained probably benign
R7695:Tacc2 UTSW 7 130728903 missense probably benign 0.08
R7766:Tacc2 UTSW 7 130743598 missense probably damaging 1.00
R7793:Tacc2 UTSW 7 130623113 missense probably benign 0.34
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGCTGCCAGGAAGGATG -3'
(R):5'- GGGTAAGTTCTACTGGCCTC -3'

Sequencing Primer
(F):5'- CTGCCAGGAAGGATGCAGAAG -3'
(R):5'- TGCTGCATCCTCACTGGCAG -3'
Posted On2014-06-30