Incidental Mutation 'R1893:Slc2a4'
ID211725
Institutional Source Beutler Lab
Gene Symbol Slc2a4
Ensembl Gene ENSMUSG00000018566
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 4
SynonymsGlut-4, Glut4
MMRRC Submission 039913-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R1893 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69942539-69948188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69946572 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 49 (Q49R)
Ref Sequence ENSEMBL: ENSMUSP00000136806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018698] [ENSMUST00000018710] [ENSMUST00000108601] [ENSMUST00000135437] [ENSMUST00000141837] [ENSMUST00000142500] [ENSMUST00000149194] [ENSMUST00000178363] [ENSMUST00000179298]
Predicted Effect probably benign
Transcript: ENSMUST00000018698
SMART Domains Protein: ENSMUSP00000018698
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 2 68 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
CSP 96 164 2.54e-21 SMART
low complexity region 173 212 N/A INTRINSIC
low complexity region 220 242 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000018710
AA Change: Q49R

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018710
Gene: ENSMUSG00000018566
AA Change: Q49R

DomainStartEndE-ValueType
Pfam:MFS_1 24 436 3.9e-16 PFAM
Pfam:Sugar_tr 27 483 1.7e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108601
SMART Domains Protein: ENSMUSP00000104242
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
CSP 19 87 2.54e-21 SMART
low complexity region 96 135 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 197 217 N/A INTRINSIC
low complexity region 240 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118013
Predicted Effect probably benign
Transcript: ENSMUST00000135437
SMART Domains Protein: ENSMUSP00000137092
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 57 5.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141837
AA Change: Q49R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136806
Gene: ENSMUSG00000018566
AA Change: Q49R

DomainStartEndE-ValueType
Pfam:MFS_1 24 438 4.7e-17 PFAM
Pfam:Sugar_tr 26 453 6e-140 PFAM
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148395
Predicted Effect probably benign
Transcript: ENSMUST00000149194
SMART Domains Protein: ENSMUSP00000136684
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 122 144 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152487
AA Change: Q46R
Predicted Effect probably damaging
Transcript: ENSMUST00000178363
AA Change: Q49R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136455
Gene: ENSMUSG00000018566
AA Change: Q49R

DomainStartEndE-ValueType
PDB:4PYP|A 14 50 3e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178809
Predicted Effect probably damaging
Transcript: ENSMUST00000179298
AA Change: Q49R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136726
Gene: ENSMUSG00000018566
AA Change: Q49R

DomainStartEndE-ValueType
Pfam:Sugar_tr 26 242 6.9e-65 PFAM
Pfam:MFS_1 27 239 2e-10 PFAM
Meta Mutation Damage Score 0.2976 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired glucose metabolism in skeletal muscle and adipose tissue. Mice homozygous for a knock-out allele show premature death associated with cardiac hypertrophy, growth retardation, insulin resistance, reduced adipose tissue deposits, and muscle fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,809 Y674H possibly damaging Het
Aars2 G A 17: 45,514,799 R347Q probably benign Het
Abca15 A T 7: 120,340,553 M293L possibly damaging Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Aldh1l2 G T 10: 83,492,536 N772K probably damaging Het
Ascc2 T A 11: 4,672,305 L457Q probably benign Het
Aspm T A 1: 139,479,867 I2164N probably damaging Het
Cabs1 A G 5: 87,980,035 T182A probably benign Het
Carmil1 T C 13: 24,024,463 E833G possibly damaging Het
Ccdc102a G A 8: 94,913,543 T41M probably damaging Het
Clec2h T C 6: 128,670,832 V48A probably benign Het
Cpb2 G A 14: 75,255,963 V27I probably benign Het
Cr2 T C 1: 195,155,187 H1201R probably benign Het
Cyp2d9 T C 15: 82,452,606 V52A probably damaging Het
Cyp4a12a C A 4: 115,326,667 N223K probably benign Het
Cyp7b1 G A 3: 18,096,567 S336L possibly damaging Het
D230025D16Rik G T 8: 105,246,501 V248F probably damaging Het
Dnah10 T C 5: 124,754,317 V803A probably benign Het
Dnah17 T A 11: 118,066,968 T2745S probably benign Het
E330021D16Rik A G 6: 136,401,827 S2P possibly damaging Het
Ep300 T A 15: 81,631,646 probably benign Het
Epha3 A G 16: 63,568,399 S829P probably damaging Het
Fads3 C A 19: 10,056,504 H418N probably benign Het
Fat1 T C 8: 45,023,856 S1980P probably damaging Het
Fgf20 T C 8: 40,279,803 E198G possibly damaging Het
Fgl2 G A 5: 21,375,671 R337H probably benign Het
Gbp2 G T 3: 142,630,172 probably benign Het
Gja10 G A 4: 32,601,541 S281L probably benign Het
Gm5422 G A 10: 31,249,613 noncoding transcript Het
Gmpr T A 13: 45,520,947 D129E possibly damaging Het
Gtf3c4 C T 2: 28,834,362 V453I possibly damaging Het
Heatr6 T C 11: 83,757,314 V111A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hpn T A 7: 31,099,348 D103V probably damaging Het
Ipcef1 G A 10: 6,900,680 R304W probably damaging Het
Iqcb1 A G 16: 36,831,883 D52G probably damaging Het
Klhdc7b C T 15: 89,387,695 probably null Het
Klhl1 A T 14: 96,240,206 probably null Het
Lrrn1 A T 6: 107,568,122 I294F possibly damaging Het
Map3k1 A T 13: 111,768,033 F406I possibly damaging Het
Map4k4 T A 1: 40,001,557 V579E probably benign Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mdga1 A T 17: 29,849,226 Y305N probably damaging Het
Mgl2 T A 11: 70,134,167 probably null Het
Mnx1 C T 5: 29,477,830 G149D unknown Het
Mtbp T A 15: 55,557,668 S17T probably benign Het
Neu3 T C 7: 99,823,420 T37A possibly damaging Het
Nr1i3 T C 1: 171,217,223 probably null Het
Odf3l1 A G 9: 56,849,214 Y173H probably benign Het
Olfr118 A T 17: 37,672,856 K278* probably null Het
Olfr466 T A 13: 65,152,992 M256K possibly damaging Het
Olfr522 T C 7: 140,162,821 N43S probably damaging Het
Olfr981 A T 9: 40,022,974 I194F possibly damaging Het
Osr2 A G 15: 35,300,462 T55A possibly damaging Het
Palld A G 8: 61,516,621 V981A probably damaging Het
Pbx1 A T 1: 168,203,410 M213K possibly damaging Het
Pcdhb12 C A 18: 37,437,083 H427Q probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Polm T C 11: 5,835,574 T162A possibly damaging Het
Prox1 A G 1: 190,160,518 probably benign Het
Ptpn7 A T 1: 135,134,903 T127S probably benign Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rab21 T C 10: 115,290,900 T181A probably benign Het
Rab38 A T 7: 88,490,716 T198S probably benign Het
Rnase4 C G 14: 51,104,938 Q40E possibly damaging Het
Rnf213 T A 11: 119,416,448 W645R probably damaging Het
Rnf8 A G 17: 29,621,550 I51M probably damaging Het
Sbpl T A 17: 23,953,267 D226V unknown Het
Sdf4 T G 4: 156,000,748 I180S probably benign Het
Simc1 A G 13: 54,539,715 K99R probably damaging Het
Slco1a4 T C 6: 141,834,616 probably null Het
Slco5a1 C A 1: 12,894,472 C527F probably damaging Het
Sox6 T A 7: 115,544,568 N405I probably benign Het
Sphkap G A 1: 83,278,966 P354L probably benign Het
Spi1 A G 2: 91,114,357 D149G probably benign Het
Sptan1 T A 2: 30,020,460 D1812E probably damaging Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Sult2a6 T C 7: 14,225,889 T240A probably benign Het
Tacc2 A G 7: 130,625,325 S1247G probably benign Het
Taf4 T C 2: 179,933,030 D594G probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Ticam1 T C 17: 56,271,894 N67S probably benign Het
Tlr6 A G 5: 64,953,213 F784L probably damaging Het
Tmprss15 A G 16: 79,071,418 V202A probably benign Het
Trp53bp2 T C 1: 182,431,628 V82A probably benign Het
Ube2o C T 11: 116,548,835 V170I possibly damaging Het
Vmn1r177 G A 7: 23,866,148 T101I probably benign Het
Vmn2r68 A T 7: 85,234,659 Y79* probably null Het
Wdr35 A C 12: 8,985,994 Y255S probably benign Het
Zfp507 A T 7: 35,802,627 probably benign Het
Zfp688 G A 7: 127,419,237 R239C probably damaging Het
Zfp74 T A 7: 29,936,045 probably null Het
Zfp932 A G 5: 110,009,203 N223D possibly damaging Het
Other mutations in Slc2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc2a4 APN 11 69945956 splice site probably benign
IGL01448:Slc2a4 APN 11 69945076 missense possibly damaging 0.80
IGL01593:Slc2a4 APN 11 69944828 missense probably damaging 0.98
IGL02188:Slc2a4 APN 11 69946330 start codon destroyed probably null 0.00
IGL02738:Slc2a4 APN 11 69946114 missense probably damaging 1.00
R0282:Slc2a4 UTSW 11 69946355 missense probably damaging 1.00
R0317:Slc2a4 UTSW 11 69946356 missense probably damaging 1.00
R0709:Slc2a4 UTSW 11 69946159 missense possibly damaging 0.92
R1598:Slc2a4 UTSW 11 69945018 missense probably benign 0.00
R1800:Slc2a4 UTSW 11 69946307 missense probably benign 0.08
R1885:Slc2a4 UTSW 11 69945007 missense probably benign 0.03
R2439:Slc2a4 UTSW 11 69945625 missense possibly damaging 0.93
R2847:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2849:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2865:Slc2a4 UTSW 11 69946116 missense probably damaging 1.00
R3001:Slc2a4 UTSW 11 69945925 nonsense probably null
R3002:Slc2a4 UTSW 11 69945925 nonsense probably null
R4455:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4456:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4463:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4622:Slc2a4 UTSW 11 69944774 unclassified probably benign
R4822:Slc2a4 UTSW 11 69946587 missense probably damaging 1.00
R5695:Slc2a4 UTSW 11 69946391 missense probably damaging 1.00
R6348:Slc2a4 UTSW 11 69945022 missense probably benign 0.03
R7294:Slc2a4 UTSW 11 69945399 missense probably benign 0.00
R7315:Slc2a4 UTSW 11 69946433 missense probably damaging 0.99
R7492:Slc2a4 UTSW 11 69946376 missense probably benign 0.42
R8060:Slc2a4 UTSW 11 69945010 missense possibly damaging 0.68
X0067:Slc2a4 UTSW 11 69944256 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCCACCCACAGAGAAGATG -3'
(R):5'- CCTGAAGGAAGTCAAACATGAC -3'

Sequencing Primer
(F):5'- AGCGTAGTGAGGGTGCC -3'
(R):5'- ATGACTCTACATGACATACCTTCC -3'
Posted On2014-06-30