Incidental Mutation 'R1893:Mtbp'
ID211745
Institutional Source Beutler Lab
Gene Symbol Mtbp
Ensembl Gene ENSMUSG00000022369
Gene NameMdm2, transformed 3T3 cell double minute p53 binding protein
SynonymsMDM2BP
MMRRC Submission 039913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1893 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location55557408-55626423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55557668 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 17 (S17T)
Ref Sequence ENSEMBL: ENSMUSP00000129396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022998] [ENSMUST00000164542] [ENSMUST00000170046] [ENSMUST00000172387]
Predicted Effect probably benign
Transcript: ENSMUST00000022998
AA Change: S17T

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022998
Gene: ENSMUSG00000022369
AA Change: S17T

DomainStartEndE-ValueType
Pfam:MTBP_N 1 270 1.2e-116 PFAM
Pfam:MTBP_mid 287 626 1.4e-161 PFAM
Pfam:MTBP_C 630 884 1.3e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107207
Predicted Effect probably benign
Transcript: ENSMUST00000164542
SMART Domains Protein: ENSMUSP00000127456
Gene: ENSMUSG00000022370

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 18 55 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169517
Predicted Effect probably benign
Transcript: ENSMUST00000170046
AA Change: S17T

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129396
Gene: ENSMUSG00000022369
AA Change: S17T

DomainStartEndE-ValueType
Pfam:MTBP_N 1 276 3.4e-145 PFAM
Pfam:MTBP_mid 286 626 3.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170135
Predicted Effect probably benign
Transcript: ENSMUST00000172387
SMART Domains Protein: ENSMUSP00000130722
Gene: ENSMUSG00000022370

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 17 141 2.8e-47 PFAM
Meta Mutation Damage Score 0.0967 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncoprotein mouse double minute 2. The encoded protein regulates progression through the cell cycle and may be involved in tumor formation. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a reporter allele exhibit early embryonic lethality; interestingly, heterozygous mice are not tumor prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,809 Y674H possibly damaging Het
Aars2 G A 17: 45,514,799 R347Q probably benign Het
Abca15 A T 7: 120,340,553 M293L possibly damaging Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Aldh1l2 G T 10: 83,492,536 N772K probably damaging Het
Ascc2 T A 11: 4,672,305 L457Q probably benign Het
Aspm T A 1: 139,479,867 I2164N probably damaging Het
Cabs1 A G 5: 87,980,035 T182A probably benign Het
Carmil1 T C 13: 24,024,463 E833G possibly damaging Het
Ccdc102a G A 8: 94,913,543 T41M probably damaging Het
Clec2h T C 6: 128,670,832 V48A probably benign Het
Cpb2 G A 14: 75,255,963 V27I probably benign Het
Cr2 T C 1: 195,155,187 H1201R probably benign Het
Cyp2d9 T C 15: 82,452,606 V52A probably damaging Het
Cyp4a12a C A 4: 115,326,667 N223K probably benign Het
Cyp7b1 G A 3: 18,096,567 S336L possibly damaging Het
D230025D16Rik G T 8: 105,246,501 V248F probably damaging Het
Dnah10 T C 5: 124,754,317 V803A probably benign Het
Dnah17 T A 11: 118,066,968 T2745S probably benign Het
E330021D16Rik A G 6: 136,401,827 S2P possibly damaging Het
Ep300 T A 15: 81,631,646 probably benign Het
Epha3 A G 16: 63,568,399 S829P probably damaging Het
Fads3 C A 19: 10,056,504 H418N probably benign Het
Fat1 T C 8: 45,023,856 S1980P probably damaging Het
Fgf20 T C 8: 40,279,803 E198G possibly damaging Het
Fgl2 G A 5: 21,375,671 R337H probably benign Het
Gbp2 G T 3: 142,630,172 probably benign Het
Gja10 G A 4: 32,601,541 S281L probably benign Het
Gm5422 G A 10: 31,249,613 noncoding transcript Het
Gmpr T A 13: 45,520,947 D129E possibly damaging Het
Gtf3c4 C T 2: 28,834,362 V453I possibly damaging Het
Heatr6 T C 11: 83,757,314 V111A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hpn T A 7: 31,099,348 D103V probably damaging Het
Ipcef1 G A 10: 6,900,680 R304W probably damaging Het
Iqcb1 A G 16: 36,831,883 D52G probably damaging Het
Klhdc7b C T 15: 89,387,695 probably null Het
Klhl1 A T 14: 96,240,206 probably null Het
Lrrn1 A T 6: 107,568,122 I294F possibly damaging Het
Map3k1 A T 13: 111,768,033 F406I possibly damaging Het
Map4k4 T A 1: 40,001,557 V579E probably benign Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mdga1 A T 17: 29,849,226 Y305N probably damaging Het
Mgl2 T A 11: 70,134,167 probably null Het
Mnx1 C T 5: 29,477,830 G149D unknown Het
Neu3 T C 7: 99,823,420 T37A possibly damaging Het
Nr1i3 T C 1: 171,217,223 probably null Het
Odf3l1 A G 9: 56,849,214 Y173H probably benign Het
Olfr118 A T 17: 37,672,856 K278* probably null Het
Olfr466 T A 13: 65,152,992 M256K possibly damaging Het
Olfr522 T C 7: 140,162,821 N43S probably damaging Het
Olfr981 A T 9: 40,022,974 I194F possibly damaging Het
Osr2 A G 15: 35,300,462 T55A possibly damaging Het
Palld A G 8: 61,516,621 V981A probably damaging Het
Pbx1 A T 1: 168,203,410 M213K possibly damaging Het
Pcdhb12 C A 18: 37,437,083 H427Q probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Polm T C 11: 5,835,574 T162A possibly damaging Het
Prox1 A G 1: 190,160,518 probably benign Het
Ptpn7 A T 1: 135,134,903 T127S probably benign Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rab21 T C 10: 115,290,900 T181A probably benign Het
Rab38 A T 7: 88,490,716 T198S probably benign Het
Rnase4 C G 14: 51,104,938 Q40E possibly damaging Het
Rnf213 T A 11: 119,416,448 W645R probably damaging Het
Rnf8 A G 17: 29,621,550 I51M probably damaging Het
Sbpl T A 17: 23,953,267 D226V unknown Het
Sdf4 T G 4: 156,000,748 I180S probably benign Het
Simc1 A G 13: 54,539,715 K99R probably damaging Het
Slc2a4 T C 11: 69,946,572 Q49R probably damaging Het
Slco1a4 T C 6: 141,834,616 probably null Het
Slco5a1 C A 1: 12,894,472 C527F probably damaging Het
Sox6 T A 7: 115,544,568 N405I probably benign Het
Sphkap G A 1: 83,278,966 P354L probably benign Het
Spi1 A G 2: 91,114,357 D149G probably benign Het
Sptan1 T A 2: 30,020,460 D1812E probably damaging Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Sult2a6 T C 7: 14,225,889 T240A probably benign Het
Tacc2 A G 7: 130,625,325 S1247G probably benign Het
Taf4 T C 2: 179,933,030 D594G probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Ticam1 T C 17: 56,271,894 N67S probably benign Het
Tlr6 A G 5: 64,953,213 F784L probably damaging Het
Tmprss15 A G 16: 79,071,418 V202A probably benign Het
Trp53bp2 T C 1: 182,431,628 V82A probably benign Het
Ube2o C T 11: 116,548,835 V170I possibly damaging Het
Vmn1r177 G A 7: 23,866,148 T101I probably benign Het
Vmn2r68 A T 7: 85,234,659 Y79* probably null Het
Wdr35 A C 12: 8,985,994 Y255S probably benign Het
Zfp507 A T 7: 35,802,627 probably benign Het
Zfp688 G A 7: 127,419,237 R239C probably damaging Het
Zfp74 T A 7: 29,936,045 probably null Het
Zfp932 A G 5: 110,009,203 N223D possibly damaging Het
Other mutations in Mtbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Mtbp APN 15 55617508 nonsense probably null
IGL00988:Mtbp APN 15 55558498 unclassified probably benign
IGL01608:Mtbp APN 15 55557689 nonsense probably null
IGL02422:Mtbp APN 15 55563043 missense possibly damaging 0.59
IGL02664:Mtbp APN 15 55619643 missense probably benign 0.01
IGL03160:Mtbp APN 15 55620617 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0280:Mtbp UTSW 15 55586461 missense probably benign 0.04
R0302:Mtbp UTSW 15 55625424 missense probably damaging 0.99
R0387:Mtbp UTSW 15 55611029 missense possibly damaging 0.82
R0402:Mtbp UTSW 15 55569070 nonsense probably null
R0648:Mtbp UTSW 15 55603201 missense probably benign
R0735:Mtbp UTSW 15 55562942 nonsense probably null
R0845:Mtbp UTSW 15 55563090 critical splice donor site probably null
R1186:Mtbp UTSW 15 55564671 missense probably null 1.00
R1398:Mtbp UTSW 15 55577537 nonsense probably null
R1500:Mtbp UTSW 15 55617555 missense probably damaging 0.99
R1712:Mtbp UTSW 15 55571294 critical splice acceptor site probably null
R1902:Mtbp UTSW 15 55606715 missense probably damaging 0.99
R1917:Mtbp UTSW 15 55564677 splice site probably benign
R2267:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2268:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2269:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2383:Mtbp UTSW 15 55566194 missense probably damaging 1.00
R2512:Mtbp UTSW 15 55577536 missense probably damaging 0.98
R2924:Mtbp UTSW 15 55619814 missense probably benign 0.21
R2925:Mtbp UTSW 15 55619814 missense probably benign 0.21
R4164:Mtbp UTSW 15 55609521 missense probably benign
R4232:Mtbp UTSW 15 55620677 nonsense probably null
R4255:Mtbp UTSW 15 55620685 missense possibly damaging 0.66
R4438:Mtbp UTSW 15 55603215 missense probably benign 0.41
R5009:Mtbp UTSW 15 55603187 missense probably benign
R5132:Mtbp UTSW 15 55558569 missense possibly damaging 0.92
R5685:Mtbp UTSW 15 55562772 missense probably damaging 1.00
R5933:Mtbp UTSW 15 55571327 missense possibly damaging 0.92
R6377:Mtbp UTSW 15 55557620 start codon destroyed probably null 0.32
R6554:Mtbp UTSW 15 55567249 missense probably damaging 0.99
R6811:Mtbp UTSW 15 55606546 splice site probably null
R6942:Mtbp UTSW 15 55567200 missense probably damaging 0.99
R7134:Mtbp UTSW 15 55558565 missense probably benign 0.00
R7374:Mtbp UTSW 15 55562959 missense possibly damaging 0.95
R7397:Mtbp UTSW 15 55569151 missense probably benign 0.06
R7520:Mtbp UTSW 15 55577346 intron probably benign
R7655:Mtbp UTSW 15 55609526 missense unknown
R7656:Mtbp UTSW 15 55609526 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTCGTTATGAGAGGAGCAGAG -3'
(R):5'- AGTTAGTTGCACGTTCCCGG -3'

Sequencing Primer
(F):5'- GTGGCTCCTGAGAGAATAATTTCCC -3'
(R):5'- GGACCATTCGACCTATGCG -3'
Posted On2014-06-30