Incidental Mutation 'R1893:Ep300'
ID211746
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene NameE1A binding protein p300
SynonymsKAT3B, p300
MMRRC Submission 039913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1893 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81585351-81652077 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 81631646 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387]
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: D1097E
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: D1097E

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205816
Predicted Effect probably benign
Transcript: ENSMUST00000206833
Meta Mutation Damage Score 0.9471 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,809 Y674H possibly damaging Het
Aars2 G A 17: 45,514,799 R347Q probably benign Het
Abca15 A T 7: 120,340,553 M293L possibly damaging Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Aldh1l2 G T 10: 83,492,536 N772K probably damaging Het
Ascc2 T A 11: 4,672,305 L457Q probably benign Het
Aspm T A 1: 139,479,867 I2164N probably damaging Het
Cabs1 A G 5: 87,980,035 T182A probably benign Het
Carmil1 T C 13: 24,024,463 E833G possibly damaging Het
Ccdc102a G A 8: 94,913,543 T41M probably damaging Het
Clec2h T C 6: 128,670,832 V48A probably benign Het
Cpb2 G A 14: 75,255,963 V27I probably benign Het
Cr2 T C 1: 195,155,187 H1201R probably benign Het
Cyp2d9 T C 15: 82,452,606 V52A probably damaging Het
Cyp4a12a C A 4: 115,326,667 N223K probably benign Het
Cyp7b1 G A 3: 18,096,567 S336L possibly damaging Het
D230025D16Rik G T 8: 105,246,501 V248F probably damaging Het
Dnah10 T C 5: 124,754,317 V803A probably benign Het
Dnah17 T A 11: 118,066,968 T2745S probably benign Het
E330021D16Rik A G 6: 136,401,827 S2P possibly damaging Het
Epha3 A G 16: 63,568,399 S829P probably damaging Het
Fads3 C A 19: 10,056,504 H418N probably benign Het
Fat1 T C 8: 45,023,856 S1980P probably damaging Het
Fgf20 T C 8: 40,279,803 E198G possibly damaging Het
Fgl2 G A 5: 21,375,671 R337H probably benign Het
Gbp2 G T 3: 142,630,172 probably benign Het
Gja10 G A 4: 32,601,541 S281L probably benign Het
Gm5422 G A 10: 31,249,613 noncoding transcript Het
Gmpr T A 13: 45,520,947 D129E possibly damaging Het
Gtf3c4 C T 2: 28,834,362 V453I possibly damaging Het
Heatr6 T C 11: 83,757,314 V111A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hpn T A 7: 31,099,348 D103V probably damaging Het
Ipcef1 G A 10: 6,900,680 R304W probably damaging Het
Iqcb1 A G 16: 36,831,883 D52G probably damaging Het
Klhdc7b C T 15: 89,387,695 probably null Het
Klhl1 A T 14: 96,240,206 probably null Het
Lrrn1 A T 6: 107,568,122 I294F possibly damaging Het
Map3k1 A T 13: 111,768,033 F406I possibly damaging Het
Map4k4 T A 1: 40,001,557 V579E probably benign Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mdga1 A T 17: 29,849,226 Y305N probably damaging Het
Mgl2 T A 11: 70,134,167 probably null Het
Mnx1 C T 5: 29,477,830 G149D unknown Het
Mtbp T A 15: 55,557,668 S17T probably benign Het
Neu3 T C 7: 99,823,420 T37A possibly damaging Het
Nr1i3 T C 1: 171,217,223 probably null Het
Odf3l1 A G 9: 56,849,214 Y173H probably benign Het
Olfr118 A T 17: 37,672,856 K278* probably null Het
Olfr466 T A 13: 65,152,992 M256K possibly damaging Het
Olfr522 T C 7: 140,162,821 N43S probably damaging Het
Olfr981 A T 9: 40,022,974 I194F possibly damaging Het
Osr2 A G 15: 35,300,462 T55A possibly damaging Het
Palld A G 8: 61,516,621 V981A probably damaging Het
Pbx1 A T 1: 168,203,410 M213K possibly damaging Het
Pcdhb12 C A 18: 37,437,083 H427Q probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Polm T C 11: 5,835,574 T162A possibly damaging Het
Prox1 A G 1: 190,160,518 probably benign Het
Ptpn7 A T 1: 135,134,903 T127S probably benign Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rab21 T C 10: 115,290,900 T181A probably benign Het
Rab38 A T 7: 88,490,716 T198S probably benign Het
Rnase4 C G 14: 51,104,938 Q40E possibly damaging Het
Rnf213 T A 11: 119,416,448 W645R probably damaging Het
Rnf8 A G 17: 29,621,550 I51M probably damaging Het
Sbpl T A 17: 23,953,267 D226V unknown Het
Sdf4 T G 4: 156,000,748 I180S probably benign Het
Simc1 A G 13: 54,539,715 K99R probably damaging Het
Slc2a4 T C 11: 69,946,572 Q49R probably damaging Het
Slco1a4 T C 6: 141,834,616 probably null Het
Slco5a1 C A 1: 12,894,472 C527F probably damaging Het
Sox6 T A 7: 115,544,568 N405I probably benign Het
Sphkap G A 1: 83,278,966 P354L probably benign Het
Spi1 A G 2: 91,114,357 D149G probably benign Het
Sptan1 T A 2: 30,020,460 D1812E probably damaging Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Sult2a6 T C 7: 14,225,889 T240A probably benign Het
Tacc2 A G 7: 130,625,325 S1247G probably benign Het
Taf4 T C 2: 179,933,030 D594G probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Ticam1 T C 17: 56,271,894 N67S probably benign Het
Tlr6 A G 5: 64,953,213 F784L probably damaging Het
Tmprss15 A G 16: 79,071,418 V202A probably benign Het
Trp53bp2 T C 1: 182,431,628 V82A probably benign Het
Ube2o C T 11: 116,548,835 V170I possibly damaging Het
Vmn1r177 G A 7: 23,866,148 T101I probably benign Het
Vmn2r68 A T 7: 85,234,659 Y79* probably null Het
Wdr35 A C 12: 8,985,994 Y255S probably benign Het
Zfp507 A T 7: 35,802,627 probably benign Het
Zfp688 G A 7: 127,419,237 R239C probably damaging Het
Zfp74 T A 7: 29,936,045 probably null Het
Zfp932 A G 5: 110,009,203 N223D possibly damaging Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81641418 missense unknown
IGL01128:Ep300 APN 15 81630006 unclassified probably benign
IGL01151:Ep300 APN 15 81623472 intron probably benign
IGL01414:Ep300 APN 15 81627266 unclassified probably benign
IGL01564:Ep300 APN 15 81632464 unclassified probably benign
IGL01875:Ep300 APN 15 81640023 missense unknown
IGL01945:Ep300 APN 15 81616109 unclassified probably benign
IGL02022:Ep300 APN 15 81611437 unclassified probably benign
IGL02115:Ep300 APN 15 81648818 missense unknown
IGL02129:Ep300 APN 15 81586636 missense unknown
IGL02145:Ep300 APN 15 81601166 missense unknown
IGL02149:Ep300 APN 15 81628420 unclassified probably benign
IGL02165:Ep300 APN 15 81641391 missense probably benign 0.39
IGL02226:Ep300 APN 15 81613412 missense unknown
IGL02610:Ep300 APN 15 81601522 missense unknown
IGL02731:Ep300 APN 15 81648414 missense unknown
IGL03239:Ep300 APN 15 81641388 missense unknown
BB001:Ep300 UTSW 15 81649502 missense unknown
BB011:Ep300 UTSW 15 81649502 missense unknown
R0077:Ep300 UTSW 15 81641313 missense unknown
R0145:Ep300 UTSW 15 81616127 critical splice donor site probably null
R0244:Ep300 UTSW 15 81640128 missense unknown
R0390:Ep300 UTSW 15 81640116 missense unknown
R0534:Ep300 UTSW 15 81600896 splice site probably benign
R0671:Ep300 UTSW 15 81616134 unclassified probably benign
R0840:Ep300 UTSW 15 81644933 missense unknown
R1166:Ep300 UTSW 15 81630064 unclassified probably benign
R1737:Ep300 UTSW 15 81626347 missense probably damaging 0.99
R2136:Ep300 UTSW 15 81640447 missense unknown
R3427:Ep300 UTSW 15 81601279 missense unknown
R3757:Ep300 UTSW 15 81648589 missense unknown
R3892:Ep300 UTSW 15 81619997 unclassified probably benign
R4554:Ep300 UTSW 15 81601430 missense unknown
R4575:Ep300 UTSW 15 81649009 missense unknown
R4575:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81611410 unclassified probably benign
R4577:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81649009 missense unknown
R4578:Ep300 UTSW 15 81611410 unclassified probably benign
R5021:Ep300 UTSW 15 81640023 missense unknown
R5366:Ep300 UTSW 15 81616100 missense probably benign 0.24
R5372:Ep300 UTSW 15 81636830 missense unknown
R5393:Ep300 UTSW 15 81631618 unclassified probably benign
R5410:Ep300 UTSW 15 81648854 missense unknown
R5571:Ep300 UTSW 15 81643217 intron probably benign
R5701:Ep300 UTSW 15 81601495 missense unknown
R5772:Ep300 UTSW 15 81639914 intron probably benign
R5825:Ep300 UTSW 15 81611472 missense probably benign 0.39
R5917:Ep300 UTSW 15 81628607 unclassified probably benign
R5991:Ep300 UTSW 15 81648466 missense unknown
R6019:Ep300 UTSW 15 81641382 missense unknown
R6144:Ep300 UTSW 15 81601234 missense unknown
R6291:Ep300 UTSW 15 81648507 missense unknown
R6292:Ep300 UTSW 15 81616734 unclassified probably benign
R6599:Ep300 UTSW 15 81586713 missense unknown
R6804:Ep300 UTSW 15 81641311 nonsense probably null
R6925:Ep300 UTSW 15 81649981 missense probably benign 0.32
R7327:Ep300 UTSW 15 81627314 missense unknown
R7378:Ep300 UTSW 15 81650545 missense probably damaging 0.97
R7388:Ep300 UTSW 15 81648366 missense unknown
R7419:Ep300 UTSW 15 81648514 missense unknown
R7498:Ep300 UTSW 15 81639843 missense unknown
R7584:Ep300 UTSW 15 81628426 missense unknown
R7605:Ep300 UTSW 15 81621152 missense unknown
R7619:Ep300 UTSW 15 81608198 missense unknown
R7699:Ep300 UTSW 15 81586393 start gained probably benign
R7763:Ep300 UTSW 15 81586583 start gained probably benign
R7775:Ep300 UTSW 15 81586686 missense unknown
R7778:Ep300 UTSW 15 81586686 missense unknown
R7862:Ep300 UTSW 15 81650753 missense probably damaging 1.00
R7924:Ep300 UTSW 15 81649502 missense unknown
R8155:Ep300 UTSW 15 81621068 missense unknown
R8259:Ep300 UTSW 15 81639017 missense unknown
R8276:Ep300 UTSW 15 81650028 missense possibly damaging 0.85
R8331:Ep300 UTSW 15 81601210 missense unknown
RF020:Ep300 UTSW 15 81586571 start gained probably benign
Z1177:Ep300 UTSW 15 81630097 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCAATCAACTCGTGGGACG -3'
(R):5'- GACAGGTCTGAAAGATACTTCTTACC -3'

Sequencing Primer
(F):5'- CGTGGGACGACATATCAAGACAC -3'
(R):5'- TCCAAGGCTTTGCATGACAG -3'
Posted On2014-06-30