Incidental Mutation 'R1894:Helz2'
ID 211775
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
MMRRC Submission 039914-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1894 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 180869408-180883820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 180876082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1471 (P1471S)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: P1471S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: P1471S

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: P1471S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: P1471S

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: P1471S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: P1471S

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T C 4: 129,907,419 (GRCm39) F977S probably damaging Het
Ago4 A G 4: 126,406,393 (GRCm39) Y306H probably benign Het
Cblc T C 7: 19,526,502 (GRCm39) T196A probably damaging Het
Cfap52 T A 11: 67,844,445 (GRCm39) probably null Het
Cops3 T C 11: 59,710,844 (GRCm39) N375S probably benign Het
Crb1 T C 1: 139,170,931 (GRCm39) T759A probably benign Het
Dnah3 T C 7: 119,685,557 (GRCm39) K153E probably benign Het
Elovl1 C T 4: 118,287,945 (GRCm39) S27F probably damaging Het
Erc2 A G 14: 27,863,185 (GRCm39) E804G probably damaging Het
Fam110b G T 4: 5,798,840 (GRCm39) C86F probably damaging Het
Fbn1 T A 2: 125,236,541 (GRCm39) R380W probably damaging Het
Gatad2a C T 8: 70,369,301 (GRCm39) R221Q probably damaging Het
Gcn1 C T 5: 115,727,174 (GRCm39) P677L probably damaging Het
Gm6020 C T 19: 61,172,391 (GRCm39) H22Y possibly damaging Het
Gm9817 T C 13: 45,232,605 (GRCm39) V136A unknown Het
Gmip T A 8: 70,273,622 (GRCm39) L971H probably damaging Het
Gnptab G A 10: 88,254,989 (GRCm39) E192K possibly damaging Het
Grm7 G A 6: 111,335,568 (GRCm39) V660I probably benign Het
Herc1 G A 9: 66,386,743 (GRCm39) G3786S probably damaging Het
Isg20 T C 7: 78,569,647 (GRCm39) V206A probably benign Het
Jund T A 8: 71,152,470 (GRCm39) I255N probably damaging Het
Kcnt2 A T 1: 140,353,079 (GRCm39) I263F probably damaging Het
Kif2c A T 4: 117,019,420 (GRCm39) L561Q probably benign Het
Klhl3 T C 13: 58,157,189 (GRCm39) D546G probably damaging Het
Klk1b4 A T 7: 43,859,054 (GRCm39) Q24L probably benign Het
Ltbp2 A T 12: 84,834,735 (GRCm39) C225S probably damaging Het
Mcub T C 3: 129,728,312 (GRCm39) H55R probably benign Het
Mecp2 C T X: 73,080,781 (GRCm39) A79T probably damaging Het
Med18 G A 4: 132,187,242 (GRCm39) R86* probably null Het
Mfsd2b T C 12: 4,919,155 (GRCm39) E63G probably damaging Het
Mtus1 C T 8: 41,537,362 (GRCm39) S118N probably damaging Het
Mybbp1a C T 11: 72,336,863 (GRCm39) T565I probably benign Het
Myo15b G A 11: 115,777,899 (GRCm39) G1049S probably damaging Het
Nfrkb T A 9: 31,326,064 (GRCm39) V1169E probably benign Het
Nr2f2 T A 7: 70,004,419 (GRCm39) M411L probably benign Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Nup214 A T 2: 31,886,392 (GRCm39) T585S possibly damaging Het
Or5m13 C T 2: 85,748,599 (GRCm39) T110I probably benign Het
Or6c214 A T 10: 129,590,943 (GRCm39) C125* probably null Het
Or7e177 T C 9: 20,211,633 (GRCm39) S47P probably benign Het
Or8b12b T A 9: 37,684,163 (GRCm39) D69E possibly damaging Het
Pih1d1 T A 7: 44,807,165 (GRCm39) I166N probably damaging Het
Prl2c5 T C 13: 13,366,263 (GRCm39) F181L probably benign Het
Prx C T 7: 27,218,535 (GRCm39) T1012I possibly damaging Het
Rassf8 T A 6: 145,754,199 (GRCm39) V5E probably damaging Het
Rassf9 C A 10: 102,380,755 (GRCm39) R44S possibly damaging Het
Relch A T 1: 105,592,301 (GRCm39) I157F probably benign Het
Sde2 G A 1: 180,687,573 (GRCm39) S153N probably benign Het
Sec16b T A 1: 157,380,545 (GRCm39) M372K possibly damaging Het
Sgcd A T 11: 47,085,937 (GRCm39) I71N probably damaging Het
Slco5a1 C T 1: 12,942,483 (GRCm39) C721Y probably damaging Het
Slx4ip A T 2: 136,910,038 (GRCm39) K344N probably benign Het
Sorcs3 A T 19: 48,782,713 (GRCm39) Q1076L probably benign Het
Spata21 A T 4: 140,838,692 (GRCm39) N581I possibly damaging Het
Spata31d1d G T 13: 59,875,936 (GRCm39) P533H probably benign Het
Spice1 T G 16: 44,185,989 (GRCm39) S111A probably damaging Het
Tex14 T G 11: 87,365,274 (GRCm39) F61V probably damaging Het
Timp3 C T 10: 86,181,716 (GRCm39) R196* probably null Het
Tll2 A G 19: 41,077,110 (GRCm39) probably null Het
Tppp A G 13: 74,169,326 (GRCm39) D22G possibly damaging Het
Trim24 G T 6: 37,934,013 (GRCm39) R652L probably damaging Het
Uaca T C 9: 60,777,718 (GRCm39) S702P possibly damaging Het
Uggt2 T C 14: 119,287,130 (GRCm39) E146G probably damaging Het
Vmn1r233 T C 17: 21,213,994 (GRCm39) S319G probably benign Het
Wdr47 A T 3: 108,530,692 (GRCm39) Q395L possibly damaging Het
Wrnip1 A G 13: 32,989,319 (GRCm39) probably null Het
Zfp420 A T 7: 29,573,933 (GRCm39) H51L probably damaging Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 180,871,495 (GRCm39) missense probably damaging 1.00
IGL00515:Helz2 APN 2 180,874,799 (GRCm39) nonsense probably null
IGL00704:Helz2 APN 2 180,876,178 (GRCm39) missense probably damaging 1.00
IGL00847:Helz2 APN 2 180,874,038 (GRCm39) missense possibly damaging 0.73
IGL01448:Helz2 APN 2 180,875,770 (GRCm39) missense probably damaging 1.00
IGL01783:Helz2 APN 2 180,874,674 (GRCm39) missense probably damaging 1.00
IGL01790:Helz2 APN 2 180,880,274 (GRCm39) missense probably benign 0.29
IGL02116:Helz2 APN 2 180,873,978 (GRCm39) missense probably damaging 1.00
IGL02226:Helz2 APN 2 180,873,483 (GRCm39) missense probably damaging 1.00
IGL02402:Helz2 APN 2 180,872,704 (GRCm39) missense probably damaging 1.00
IGL02403:Helz2 APN 2 180,872,815 (GRCm39) missense probably damaging 1.00
IGL02733:Helz2 APN 2 180,876,819 (GRCm39) missense probably benign 0.14
IGL02869:Helz2 APN 2 180,872,939 (GRCm39) intron probably benign
IGL03003:Helz2 APN 2 180,882,046 (GRCm39) missense probably damaging 1.00
IGL03060:Helz2 APN 2 180,871,015 (GRCm39) critical splice donor site probably null
IGL03310:Helz2 APN 2 180,873,597 (GRCm39) missense probably benign 0.00
Colby UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
ANU74:Helz2 UTSW 2 180,876,627 (GRCm39) missense probably benign 0.03
R0013:Helz2 UTSW 2 180,882,752 (GRCm39) missense probably benign
R0013:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0016:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0018:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0111:Helz2 UTSW 2 180,879,595 (GRCm39) missense probably benign 0.30
R0117:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0135:Helz2 UTSW 2 180,874,062 (GRCm39) missense probably damaging 1.00
R0194:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0254:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0410:Helz2 UTSW 2 180,872,386 (GRCm39) missense probably damaging 1.00
R0442:Helz2 UTSW 2 180,874,002 (GRCm39) missense probably damaging 0.97
R0497:Helz2 UTSW 2 180,871,449 (GRCm39) missense probably damaging 0.97
R0517:Helz2 UTSW 2 180,869,563 (GRCm39) missense probably benign 0.00
R0541:Helz2 UTSW 2 180,876,618 (GRCm39) missense possibly damaging 0.89
R0542:Helz2 UTSW 2 180,873,882 (GRCm39) missense probably damaging 1.00
R0591:Helz2 UTSW 2 180,873,909 (GRCm39) missense probably damaging 0.96
R0692:Helz2 UTSW 2 180,882,674 (GRCm39) missense probably benign
R0826:Helz2 UTSW 2 180,882,646 (GRCm39) missense possibly damaging 0.51
R0834:Helz2 UTSW 2 180,872,570 (GRCm39) missense probably damaging 1.00
R0880:Helz2 UTSW 2 180,877,928 (GRCm39) missense probably benign
R1170:Helz2 UTSW 2 180,871,608 (GRCm39) missense probably damaging 1.00
R1186:Helz2 UTSW 2 180,872,921 (GRCm39) missense probably damaging 1.00
R1344:Helz2 UTSW 2 180,879,389 (GRCm39) missense possibly damaging 0.89
R1358:Helz2 UTSW 2 180,874,774 (GRCm39) missense probably damaging 1.00
R1436:Helz2 UTSW 2 180,877,317 (GRCm39) missense probably damaging 0.99
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1477:Helz2 UTSW 2 180,874,597 (GRCm39) missense probably benign 0.00
R1564:Helz2 UTSW 2 180,875,021 (GRCm39) missense probably benign 0.01
R1584:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1655:Helz2 UTSW 2 180,875,940 (GRCm39) missense probably damaging 0.99
R1757:Helz2 UTSW 2 180,878,056 (GRCm39) missense probably damaging 1.00
R1779:Helz2 UTSW 2 180,880,252 (GRCm39) missense possibly damaging 0.84
R1779:Helz2 UTSW 2 180,876,780 (GRCm39) missense probably benign
R1837:Helz2 UTSW 2 180,871,082 (GRCm39) missense probably damaging 1.00
R1845:Helz2 UTSW 2 180,873,878 (GRCm39) missense probably benign 0.02
R1913:Helz2 UTSW 2 180,875,543 (GRCm39) missense probably damaging 1.00
R2005:Helz2 UTSW 2 180,873,122 (GRCm39) missense probably benign 0.45
R2034:Helz2 UTSW 2 180,874,371 (GRCm39) missense probably damaging 1.00
R2036:Helz2 UTSW 2 180,879,272 (GRCm39) missense probably benign 0.03
R2061:Helz2 UTSW 2 180,882,337 (GRCm39) missense probably damaging 1.00
R2088:Helz2 UTSW 2 180,876,895 (GRCm39) missense probably benign 0.07
R2142:Helz2 UTSW 2 180,873,173 (GRCm39) missense probably benign
R2180:Helz2 UTSW 2 180,875,525 (GRCm39) missense probably damaging 1.00
R2192:Helz2 UTSW 2 180,870,841 (GRCm39) nonsense probably null
R2248:Helz2 UTSW 2 180,875,226 (GRCm39) missense probably benign 0.33
R2495:Helz2 UTSW 2 180,874,705 (GRCm39) missense probably damaging 0.99
R2886:Helz2 UTSW 2 180,882,535 (GRCm39) missense probably benign
R3617:Helz2 UTSW 2 180,874,854 (GRCm39) missense probably damaging 1.00
R3776:Helz2 UTSW 2 180,882,182 (GRCm39) nonsense probably null
R3803:Helz2 UTSW 2 180,881,789 (GRCm39) missense probably damaging 0.96
R4043:Helz2 UTSW 2 180,871,503 (GRCm39) missense probably benign 0.00
R4052:Helz2 UTSW 2 180,882,268 (GRCm39) missense probably damaging 1.00
R4232:Helz2 UTSW 2 180,871,695 (GRCm39) missense probably damaging 1.00
R4521:Helz2 UTSW 2 180,870,626 (GRCm39) missense probably benign
R4624:Helz2 UTSW 2 180,881,101 (GRCm39) missense probably damaging 0.99
R4720:Helz2 UTSW 2 180,880,210 (GRCm39) missense probably damaging 1.00
R4831:Helz2 UTSW 2 180,879,210 (GRCm39) missense probably damaging 1.00
R4852:Helz2 UTSW 2 180,871,913 (GRCm39) missense probably damaging 1.00
R4894:Helz2 UTSW 2 180,877,940 (GRCm39) missense probably benign 0.01
R4915:Helz2 UTSW 2 180,874,231 (GRCm39) missense possibly damaging 0.80
R4965:Helz2 UTSW 2 180,882,709 (GRCm39) missense possibly damaging 0.79
R5022:Helz2 UTSW 2 180,882,362 (GRCm39) missense probably benign
R5089:Helz2 UTSW 2 180,876,942 (GRCm39) missense probably benign 0.14
R5190:Helz2 UTSW 2 180,872,550 (GRCm39) critical splice donor site probably null
R5309:Helz2 UTSW 2 180,876,639 (GRCm39) missense probably benign 0.08
R5358:Helz2 UTSW 2 180,877,321 (GRCm39) missense probably damaging 1.00
R5379:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R5559:Helz2 UTSW 2 180,871,919 (GRCm39) missense probably damaging 0.98
R5591:Helz2 UTSW 2 180,882,051 (GRCm39) missense probably damaging 0.99
R5596:Helz2 UTSW 2 180,879,082 (GRCm39) intron probably benign
R5805:Helz2 UTSW 2 180,882,301 (GRCm39) missense probably damaging 1.00
R5823:Helz2 UTSW 2 180,878,189 (GRCm39) missense possibly damaging 0.92
R5825:Helz2 UTSW 2 180,874,449 (GRCm39) missense probably benign 0.02
R5873:Helz2 UTSW 2 180,875,821 (GRCm39) missense possibly damaging 0.78
R5928:Helz2 UTSW 2 180,872,177 (GRCm39) missense possibly damaging 0.82
R5936:Helz2 UTSW 2 180,872,560 (GRCm39) missense probably damaging 1.00
R5975:Helz2 UTSW 2 180,872,843 (GRCm39) missense probably benign 0.08
R6045:Helz2 UTSW 2 180,882,106 (GRCm39) missense probably benign 0.03
R6077:Helz2 UTSW 2 180,874,831 (GRCm39) missense probably benign 0.41
R6218:Helz2 UTSW 2 180,874,087 (GRCm39) missense probably benign 0.03
R6218:Helz2 UTSW 2 180,877,738 (GRCm39) missense probably damaging 1.00
R6315:Helz2 UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
R6346:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6371:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6372:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6373:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6385:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6464:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R6581:Helz2 UTSW 2 180,871,172 (GRCm39) missense probably damaging 0.99
R6651:Helz2 UTSW 2 180,881,350 (GRCm39) nonsense probably null
R6964:Helz2 UTSW 2 180,872,221 (GRCm39) missense probably damaging 1.00
R7061:Helz2 UTSW 2 180,882,307 (GRCm39) missense probably damaging 1.00
R7153:Helz2 UTSW 2 180,873,078 (GRCm39) missense probably benign 0.00
R7372:Helz2 UTSW 2 180,880,216 (GRCm39) missense possibly damaging 0.61
R7512:Helz2 UTSW 2 180,877,393 (GRCm39) splice site probably null
R7512:Helz2 UTSW 2 180,872,647 (GRCm39) missense probably benign 0.00
R7583:Helz2 UTSW 2 180,879,365 (GRCm39) missense probably benign 0.06
R7724:Helz2 UTSW 2 180,873,789 (GRCm39) missense probably damaging 1.00
R7733:Helz2 UTSW 2 180,872,148 (GRCm39) missense possibly damaging 0.63
R7748:Helz2 UTSW 2 180,876,324 (GRCm39) missense probably damaging 1.00
R7774:Helz2 UTSW 2 180,875,784 (GRCm39) missense probably benign
R7799:Helz2 UTSW 2 180,879,782 (GRCm39) missense probably benign 0.15
R7841:Helz2 UTSW 2 180,874,695 (GRCm39) missense probably damaging 1.00
R7939:Helz2 UTSW 2 180,879,543 (GRCm39) missense probably damaging 0.99
R8026:Helz2 UTSW 2 180,881,998 (GRCm39) missense probably benign 0.34
R8030:Helz2 UTSW 2 180,879,689 (GRCm39) missense possibly damaging 0.55
R8080:Helz2 UTSW 2 180,880,055 (GRCm39) missense probably damaging 0.99
R8237:Helz2 UTSW 2 180,871,124 (GRCm39) missense possibly damaging 0.65
R8245:Helz2 UTSW 2 180,879,895 (GRCm39) missense probably damaging 1.00
R8304:Helz2 UTSW 2 180,871,950 (GRCm39) missense probably benign 0.03
R8486:Helz2 UTSW 2 180,871,124 (GRCm39) missense probably damaging 1.00
R8556:Helz2 UTSW 2 180,871,350 (GRCm39) missense probably damaging 1.00
R8878:Helz2 UTSW 2 180,874,560 (GRCm39) missense possibly damaging 0.67
R8907:Helz2 UTSW 2 180,874,920 (GRCm39) missense possibly damaging 0.47
R8911:Helz2 UTSW 2 180,880,173 (GRCm39) missense
R8953:Helz2 UTSW 2 180,874,884 (GRCm39) missense probably damaging 1.00
R8963:Helz2 UTSW 2 180,871,407 (GRCm39) missense probably damaging 1.00
R8969:Helz2 UTSW 2 180,879,581 (GRCm39) missense probably benign 0.19
R8976:Helz2 UTSW 2 180,876,486 (GRCm39) missense possibly damaging 0.46
R9015:Helz2 UTSW 2 180,870,792 (GRCm39) missense probably damaging 1.00
R9031:Helz2 UTSW 2 180,874,261 (GRCm39) missense possibly damaging 0.78
R9052:Helz2 UTSW 2 180,881,968 (GRCm39) missense possibly damaging 0.78
R9089:Helz2 UTSW 2 180,881,433 (GRCm39) missense probably damaging 1.00
R9145:Helz2 UTSW 2 180,881,848 (GRCm39) missense probably damaging 1.00
R9185:Helz2 UTSW 2 180,871,883 (GRCm39) missense probably benign
R9186:Helz2 UTSW 2 180,876,457 (GRCm39) missense possibly damaging 0.57
R9373:Helz2 UTSW 2 180,882,741 (GRCm39) missense probably benign
R9407:Helz2 UTSW 2 180,881,975 (GRCm39) missense probably benign 0.01
R9465:Helz2 UTSW 2 180,874,710 (GRCm39) missense probably benign 0.01
R9502:Helz2 UTSW 2 180,878,245 (GRCm39) missense possibly damaging 0.47
R9538:Helz2 UTSW 2 180,882,014 (GRCm39) missense probably damaging 1.00
R9554:Helz2 UTSW 2 180,882,470 (GRCm39) missense probably damaging 0.96
R9659:Helz2 UTSW 2 180,882,025 (GRCm39) missense probably benign 0.00
R9800:Helz2 UTSW 2 180,882,616 (GRCm39) missense probably damaging 0.99
X0064:Helz2 UTSW 2 180,873,534 (GRCm39) missense probably damaging 1.00
Z1176:Helz2 UTSW 2 180,879,357 (GRCm39) missense probably benign 0.39
Z1177:Helz2 UTSW 2 180,877,754 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGATATAAAGGCCCTGCTC -3'
(R):5'- AGGTGCTAGTACAGATCCTGGG -3'

Sequencing Primer
(F):5'- TAGTAGAAACGTTCCCGC -3'
(R):5'- TAGTACAGATCCTGGGTCCGG -3'
Posted On 2014-06-30