Incidental Mutation 'R1894:Ago4'
ID211783
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Nameargonaute RISC catalytic subunit 4
Synonymsargonaute 4, Eif2c4, 5730550L01Rik
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126489541-126533472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126512600 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 306 (Y306H)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
Predicted Effect probably benign
Transcript: ENSMUST00000084289
AA Change: Y306H

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: Y306H

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122951
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126517133 missense probably benign 0.01
IGL00965:Ago4 APN 4 126493314 missense probably benign 0.01
IGL01306:Ago4 APN 4 126515884 splice site probably null
IGL01943:Ago4 APN 4 126517195 missense probably damaging 1.00
IGL02079:Ago4 APN 4 126517084 missense probably damaging 0.99
IGL02117:Ago4 APN 4 126516852 missense probably benign 0.00
IGL02229:Ago4 APN 4 126511532 missense probably benign 0.34
IGL02503:Ago4 APN 4 126496805 nonsense probably null
IGL02504:Ago4 APN 4 126517439 missense probably benign 0.00
IGL02975:Ago4 APN 4 126512519 critical splice donor site probably null
BB010:Ago4 UTSW 4 126507018 missense probably benign 0.22
BB020:Ago4 UTSW 4 126507018 missense probably benign 0.22
IGL02837:Ago4 UTSW 4 126497300 missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126517183 missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126516932 missense probably benign 0.24
R0480:Ago4 UTSW 4 126526077 missense probably benign 0.00
R0533:Ago4 UTSW 4 126516860 missense probably benign 0.00
R1014:Ago4 UTSW 4 126506785 missense probably damaging 1.00
R1350:Ago4 UTSW 4 126507132 missense probably benign 0.04
R1547:Ago4 UTSW 4 126511413 missense probably benign 0.01
R1900:Ago4 UTSW 4 126516936 missense probably benign 0.00
R2510:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R2511:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R4063:Ago4 UTSW 4 126515862 intron probably benign
R4064:Ago4 UTSW 4 126515862 intron probably benign
R4120:Ago4 UTSW 4 126496807 missense probably damaging 1.00
R4916:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4917:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4918:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4941:Ago4 UTSW 4 126526054 missense probably benign 0.00
R5169:Ago4 UTSW 4 126511727 missense probably benign 0.06
R5262:Ago4 UTSW 4 126496764 missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126517556 missense probably benign
R5757:Ago4 UTSW 4 126526084 missense probably damaging 1.00
R6244:Ago4 UTSW 4 126511487 missense possibly damaging 0.67
R6256:Ago4 UTSW 4 126520226 missense probably damaging 1.00
R6389:Ago4 UTSW 4 126507244 missense probably damaging 1.00
R6545:Ago4 UTSW 4 126512018 missense probably benign 0.10
R7378:Ago4 UTSW 4 126511464 missense probably benign
R7804:Ago4 UTSW 4 126512630 missense probably benign 0.02
R7890:Ago4 UTSW 4 126526076 missense probably benign 0.00
R7933:Ago4 UTSW 4 126507018 missense probably benign 0.22
X0062:Ago4 UTSW 4 126515941 missense probably benign 0.00
X0064:Ago4 UTSW 4 126517482 missense possibly damaging 0.87
Z1176:Ago4 UTSW 4 126520190 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCCTCAAGTTTATAACACCTTG -3'
(R):5'- AATGAGCTATCTTGCTGCCTCC -3'

Sequencing Primer
(F):5'- GAACTCACTTTATAGACCAGGCTGG -3'
(R):5'- AACACATGGCTCTGTGCATG -3'
Posted On2014-06-30