Mutagenetix > Incidental Mutations

Incidental Mutation 'R1894:Adgrb2'

211784

Institutional Source

Beutler Lab

Gene Symbol

Adgrb2

Ensembl Gene

ENSMUSG00000028782

Gene Name

adhesion G protein-coupled receptor B2

Synonyms

Bai2

MMRRC Submission

039914-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129984870-130022633 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130013626 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 977 (F977S)

Ref Sequence

ENSEMBL: ENSMUSP00000101639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030571] [ENSMUST00000097868] [ENSMUST00000106015] [ENSMUST00000106017] [ENSMUST00000106018] [ENSMUST00000120204] [ENSMUST00000121049]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030571
AA Change: F1032S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030571
Gene: ENSMUSG00000028782
AA Change: F1032S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	1.86e-13	SMART
TSP1	413	463	9.89e-9	SMART
TSP1	469	519	3.09e-10	SMART
HormR	521	587	3.27e-18	SMART
Pfam:GAIN	600	842	1.6e-41	PFAM
GPS	864	917	2.57e-19	SMART
Pfam:7tm_2	923	1192	1.7e-67	PFAM
low complexity region	1357	1371	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097868
AA Change: F1032S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095480
Gene: ENSMUSG00000028782
AA Change: F1032S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	1.86e-13	SMART
TSP1	413	463	9.89e-9	SMART
TSP1	469	519	3.09e-10	SMART
HormR	521	587	3.27e-18	SMART
Pfam:DUF3497	597	859	1.2e-54	PFAM
GPS	864	917	2.57e-19	SMART
Pfam:7tm_2	923	1159	2.6e-69	PFAM
low complexity region	1324	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000106012

Predicted Effect

probably damaging
Transcript: ENSMUST00000106015
AA Change: F1032S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101636
Gene: ENSMUSG00000028782
AA Change: F1032S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	1.86e-13	SMART
TSP1	413	463	9.89e-9	SMART
TSP1	469	519	3.09e-10	SMART
HormR	521	587	3.27e-18	SMART
Pfam:DUF3497	597	859	6.4e-55	PFAM
GPS	864	917	2.57e-19	SMART
Pfam:7tm_2	923	1192	4.1e-68	PFAM
low complexity region	1357	1371	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106017
AA Change: F1032S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101638
Gene: ENSMUSG00000028782
AA Change: F1032S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	1.86e-13	SMART
TSP1	413	463	9.89e-9	SMART
TSP1	469	519	3.09e-10	SMART
HormR	521	587	3.27e-18	SMART
Pfam:DUF3497	597	859	6.3e-55	PFAM
GPS	864	917	2.57e-19	SMART
Pfam:7tm_2	923	1180	4.6e-68	PFAM
low complexity region	1345	1359	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106018
AA Change: F977S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101639
Gene: ENSMUSG00000028782
AA Change: F977S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	1.86e-13	SMART
TSP1	358	408	9.89e-9	SMART
TSP1	414	464	3.09e-10	SMART
HormR	466	532	3.27e-18	SMART
Pfam:DUF3497	542	804	1.1e-54	PFAM
GPS	809	862	2.57e-19	SMART
Pfam:7tm_2	868	1104	2.4e-69	PFAM
low complexity region	1269	1283	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120204
AA Change: F977S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112524
Gene: ENSMUSG00000028782
AA Change: F977S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	9.52e-11	SMART
TSP1	358	408	9.89e-9	SMART
TSP1	414	464	3.09e-10	SMART
HormR	466	532	3.27e-18	SMART
Pfam:DUF3497	542	804	8.2e-55	PFAM
GPS	809	862	2.57e-19	SMART
Pfam:7tm_2	868	1104	9.6e-70	PFAM
low complexity region	1269	1283	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121049
AA Change: F977S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112869
Gene: ENSMUSG00000028782
AA Change: F977S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
low complexity region	160	173	N/A	INTRINSIC
low complexity region	197	208	N/A	INTRINSIC
low complexity region	272	278	N/A	INTRINSIC
TSP1	303	353	1.86e-13	SMART
TSP1	358	408	9.89e-9	SMART
TSP1	414	464	3.09e-10	SMART
HormR	466	532	3.27e-18	SMART
Pfam:DUF3497	542	804	6.1e-55	PFAM
GPS	809	862	2.57e-19	SMART
Pfam:7tm_2	868	1137	3.8e-68	PFAM
low complexity region	1302	1316	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136416

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149282

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166118

Meta Mutation Damage Score

0.9509

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a a seven-span transmembrane protein that is thought to be a member of the secretin receptor family. The encoded protein is a brain-specific inhibitor of angiogenesis. The mature peptide may be further cleaved into additional products (PMID:20367554). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene show a lessening of depression like behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	T	1: 105,664,576	I157F	probably benign	Het
Ago4	A	G	4: 126,512,600	Y306H	probably benign	Het
Cblc	T	C	7: 19,792,577	T196A	probably damaging	Het
Ccdc109b	T	C	3: 129,934,663	H55R	probably benign	Het
Cfap52	T	A	11: 67,953,619		probably null	Het
Cops3	T	C	11: 59,820,018	N375S	probably benign	Het
Crb1	T	C	1: 139,243,193	T759A	probably benign	Het
Dnah3	T	C	7: 120,086,334	K153E	probably benign	Het
Elovl1	C	T	4: 118,430,748	S27F	probably damaging	Het
Erc2	A	G	14: 28,141,228	E804G	probably damaging	Het
Fam110b	G	T	4: 5,798,840	C86F	probably damaging	Het
Fbn1	T	A	2: 125,394,621	R380W	probably damaging	Het
Gatad2a	C	T	8: 69,916,651	R221Q	probably damaging	Het
Gcn1l1	C	T	5: 115,589,115	P677L	probably damaging	Het
Gm6020	C	T	19: 61,183,953	H22Y	possibly damaging	Het
Gm9817	T	C	13: 45,079,129	V136A	unknown	Het
Gmip	T	A	8: 69,820,972	L971H	probably damaging	Het
Gnptab	G	A	10: 88,419,127	E192K	possibly damaging	Het
Grm7	G	A	6: 111,358,607	V660I	probably benign	Het
Helz2	G	A	2: 181,234,289	P1471S	probably damaging	Het
Herc1	G	A	9: 66,479,461	G3786S	probably damaging	Het
Isg20	T	C	7: 78,919,899	V206A	probably benign	Het
Jund	T	A	8: 70,699,821	I255N	probably damaging	Het
Kcnt2	A	T	1: 140,425,341	I263F	probably damaging	Het
Kif2c	A	T	4: 117,162,223	L561Q	probably benign	Het
Klhl3	T	C	13: 58,009,375	D546G	probably damaging	Het
Klk1b4	A	T	7: 44,209,630	Q24L	probably benign	Het
Ltbp2	A	T	12: 84,787,961	C225S	probably damaging	Het
Mecp2	C	T	X: 74,037,175	A79T	probably damaging	Het
Med18	G	A	4: 132,459,931	R86*	probably null	Het
Mfsd2b	T	C	12: 4,869,155	E63G	probably damaging	Het
Mtus1	C	T	8: 41,084,325	S118N	probably damaging	Het
Mybbp1a	C	T	11: 72,446,037	T565I	probably benign	Het
Myo15b	G	A	11: 115,887,073	G1049S	probably damaging	Het
Nfrkb	T	A	9: 31,414,768	V1169E	probably benign	Het
Nr2f2	T	A	7: 70,354,671	M411L	probably benign	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Nup214	A	T	2: 31,996,380	T585S	possibly damaging	Het
Olfr1025-ps1	C	T	2: 85,918,255	T110I	probably benign	Het
Olfr807	A	T	10: 129,755,074	C125*	probably null	Het
Olfr873	T	C	9: 20,300,337	S47P	probably benign	Het
Olfr875	T	A	9: 37,772,867	D69E	possibly damaging	Het
Pih1d1	T	A	7: 45,157,741	I166N	probably damaging	Het
Prl2c5	T	C	13: 13,191,678	F181L	probably benign	Het
Prx	C	T	7: 27,519,110	T1012I	possibly damaging	Het
Rassf8	T	A	6: 145,808,473	V5E	probably damaging	Het
Rassf9	C	A	10: 102,544,894	R44S	possibly damaging	Het
Sde2	G	A	1: 180,860,008	S153N	probably benign	Het
Sec16b	T	A	1: 157,552,975	M372K	possibly damaging	Het
Sgcd	A	T	11: 47,195,110	I71N	probably damaging	Het
Slco5a1	C	T	1: 12,872,259	C721Y	probably damaging	Het
Slx4ip	A	T	2: 137,068,118	K344N	probably benign	Het
Sorcs3	A	T	19: 48,794,274	Q1076L	probably benign	Het
Spata21	A	T	4: 141,111,381	N581I	possibly damaging	Het
Spata31d1d	G	T	13: 59,728,122	P533H	probably benign	Het
Spice1	T	G	16: 44,365,626	S111A	probably damaging	Het
Tex14	T	G	11: 87,474,448	F61V	probably damaging	Het
Timp3	C	T	10: 86,345,852	R196*	probably null	Het
Tll2	A	G	19: 41,088,671		probably null	Het
Tppp	A	G	13: 74,021,207	D22G	possibly damaging	Het
Trim24	G	T	6: 37,957,078	R652L	probably damaging	Het
Uaca	T	C	9: 60,870,436	S702P	possibly damaging	Het
Uggt2	T	C	14: 119,049,718	E146G	probably damaging	Het
Vmn1r233	T	C	17: 20,993,732	S319G	probably benign	Het
Wdr47	A	T	3: 108,623,376	Q395L	possibly damaging	Het
Wrnip1	A	G	13: 32,805,336		probably null	Het
Zfp420	A	T	7: 29,874,508	H51L	probably damaging	Het

Other mutations in Adgrb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Adgrb2	APN	4	130018805	missense	probably damaging	1.00
IGL00425:Adgrb2	APN	4	130019072	missense	probably benign	0.09
IGL00490:Adgrb2	APN	4	130011872	missense	possibly damaging	0.82
IGL00928:Adgrb2	APN	4	129992303	missense	probably benign
IGL01353:Adgrb2	APN	4	130012300	missense	probably damaging	1.00
IGL01521:Adgrb2	APN	4	129992292	missense	probably damaging	0.98
IGL01590:Adgrb2	APN	4	130013813	splice site	probably benign
IGL01813:Adgrb2	APN	4	130012566	missense	probably benign	0.00
IGL01831:Adgrb2	APN	4	130009394	missense	probably damaging	1.00
IGL01939:Adgrb2	APN	4	129992132	missense	probably damaging	0.99
IGL01960:Adgrb2	APN	4	130012384	splice site	probably benign
IGL01993:Adgrb2	APN	4	130018842	missense	possibly damaging	0.94
IGL02646:Adgrb2	APN	4	130019282	critical splice donor site	probably null
IGL02655:Adgrb2	APN	4	129992179	nonsense	probably null
IGL02695:Adgrb2	APN	4	130018832	missense	probably damaging	1.00
IGL02998:Adgrb2	APN	4	130019069	missense	probably benign	0.15
IGL03372:Adgrb2	APN	4	130017569	missense	probably benign	0.42
R0098:Adgrb2	UTSW	4	130007831	missense	probably damaging	0.99
R0206:Adgrb2	UTSW	4	129992559	missense	probably damaging	1.00
R0311:Adgrb2	UTSW	4	130017129	missense	probably damaging	1.00
R0380:Adgrb2	UTSW	4	130007831	missense	probably damaging	0.99
R0382:Adgrb2	UTSW	4	130007831	missense	probably damaging	0.99
R0492:Adgrb2	UTSW	4	130007831	missense	probably damaging	0.99
R0544:Adgrb2	UTSW	4	130017542	missense	probably damaging	0.98
R0965:Adgrb2	UTSW	4	129992416	small deletion	probably benign
R1458:Adgrb2	UTSW	4	130014591	missense	possibly damaging	0.48
R1601:Adgrb2	UTSW	4	129992837	missense	probably benign	0.43
R1711:Adgrb2	UTSW	4	129992624	missense	probably damaging	1.00
R1758:Adgrb2	UTSW	4	130011875	missense	probably damaging	1.00
R1783:Adgrb2	UTSW	4	130009305	missense	possibly damaging	0.61
R1827:Adgrb2	UTSW	4	130012557	missense	probably damaging	1.00
R1838:Adgrb2	UTSW	4	130010231	missense	probably benign	0.00
R1881:Adgrb2	UTSW	4	130010285	missense	probably damaging	1.00
R1888:Adgrb2	UTSW	4	130013626	missense	probably damaging	1.00
R1888:Adgrb2	UTSW	4	130013626	missense	probably damaging	1.00
R2275:Adgrb2	UTSW	4	130006854	missense	probably damaging	1.00
R2926:Adgrb2	UTSW	4	130008344	missense	probably damaging	1.00
R4472:Adgrb2	UTSW	4	130008353	missense	probably benign	0.12
R4490:Adgrb2	UTSW	4	130012328	missense	possibly damaging	0.91
R4499:Adgrb2	UTSW	4	129992661	missense	probably damaging	0.99
R4758:Adgrb2	UTSW	4	130009350	missense	probably damaging	1.00
R4900:Adgrb2	UTSW	4	130013875	missense	probably damaging	1.00
R4904:Adgrb2	UTSW	4	130012539	missense	possibly damaging	0.50
R4922:Adgrb2	UTSW	4	130007852	missense	probably damaging	1.00
R5330:Adgrb2	UTSW	4	130022202	missense	possibly damaging	0.92
R5331:Adgrb2	UTSW	4	130022202	missense	possibly damaging	0.92
R5550:Adgrb2	UTSW	4	130014934	critical splice acceptor site	probably null
R5995:Adgrb2	UTSW	4	130017103	missense	probably damaging	1.00
R6047:Adgrb2	UTSW	4	130018705	missense	probably damaging	1.00
R6534:Adgrb2	UTSW	4	130022219	missense	probably damaging	0.98
R6565:Adgrb2	UTSW	4	130019276	missense	probably damaging	1.00
R6813:Adgrb2	UTSW	4	130009491	missense	probably damaging	1.00
R6963:Adgrb2	UTSW	4	130014362	frame shift	probably null
R6966:Adgrb2	UTSW	4	130014362	frame shift	probably null
R7197:Adgrb2	UTSW	4	130009522	missense	probably damaging	1.00
R7409:Adgrb2	UTSW	4	130019069	missense	probably benign	0.15
R7451:Adgrb2	UTSW	4	130014557	missense	probably damaging	1.00
R7453:Adgrb2	UTSW	4	130014637	critical splice donor site	probably null
R7461:Adgrb2	UTSW	4	130021213	critical splice acceptor site	probably benign
R7511:Adgrb2	UTSW	4	130022111	missense	probably benign
R7613:Adgrb2	UTSW	4	130021213	critical splice acceptor site	probably benign
R7729:Adgrb2	UTSW	4	129992124	missense	probably benign	0.09
R7818:Adgrb2	UTSW	4	130014560	missense	probably damaging	0.98
R7818:Adgrb2	UTSW	4	130014969	missense	possibly damaging	0.70
R8033:Adgrb2	UTSW	4	130019012	missense	probably benign
R8039:Adgrb2	UTSW	4	130022268	missense	probably damaging	0.99
R8097:Adgrb2	UTSW	4	130007897	missense	probably damaging	1.00
R8256:Adgrb2	UTSW	4	130008128	missense	probably damaging	0.96
R8425:Adgrb2	UTSW	4	130005057	missense	possibly damaging	0.72
RF020:Adgrb2	UTSW	4	130010084	missense	probably damaging	1.00
Z1176:Adgrb2	UTSW	4	130017563	missense	probably damaging	1.00
Z1177:Adgrb2	UTSW	4	130011826	missense	probably damaging	0.99
Z1177:Adgrb2	UTSW	4	130019119	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAGGCCTAGCAGTCATTGTGGG -3'
(R):5'- GTTACAGGTGAGAAGGCTGC -3'

Sequencing Primer
(F):5'- CAGTCATTGTGGGAAGCTGAC -3'
(R):5'- TGAGAAGGCTGCAGGTGCTC -3'

Posted On

2014-06-30