Incidental Mutation 'R1894:Med18'
ID211785
Institutional Source Beutler Lab
Gene Symbol Med18
Ensembl Gene ENSMUSG00000066042
Gene Namemediator complex subunit 18
Synonyms2810046C01Rik
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location132458731-132463921 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 132459931 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 86 (R86*)
Ref Sequence ENSEMBL: ENSMUSP00000099627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102567] [ENSMUST00000123604]
Predicted Effect probably null
Transcript: ENSMUST00000102567
AA Change: R86*
SMART Domains Protein: ENSMUSP00000099627
Gene: ENSMUSG00000066042
AA Change: R86*

DomainStartEndE-ValueType
Pfam:Med18 19 80 1.7e-12 PFAM
Pfam:Med18 61 207 2.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123604
SMART Domains Protein: ENSMUSP00000120535
Gene: ENSMUSG00000066042

DomainStartEndE-ValueType
Pfam:Med18 64 122 9.2e-14 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MED18 is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II (Sato et al., 2003 [PubMed 12584197]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Med18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Med18 APN 4 132459619 missense probably damaging 1.00
IGL02103:Med18 APN 4 132459666 missense probably damaging 0.98
IGL02983:Med18 APN 4 132459686 nonsense probably null
IGL03031:Med18 APN 4 132459613 missense possibly damaging 0.71
R0238:Med18 UTSW 4 132460026 missense probably damaging 0.96
R0238:Med18 UTSW 4 132460026 missense probably damaging 0.96
R1737:Med18 UTSW 4 132460109 missense probably damaging 1.00
R2696:Med18 UTSW 4 132459970 missense probably damaging 1.00
R2900:Med18 UTSW 4 132459817 missense probably damaging 1.00
R3017:Med18 UTSW 4 132459817 missense probably damaging 1.00
R3019:Med18 UTSW 4 132459817 missense probably damaging 1.00
R3980:Med18 UTSW 4 132462940 missense probably benign 0.02
R4648:Med18 UTSW 4 132462963 missense possibly damaging 0.86
R5330:Med18 UTSW 4 132463066 intron probably benign
R6049:Med18 UTSW 4 132459713 missense probably benign
R6694:Med18 UTSW 4 132459982 missense probably benign 0.06
R6931:Med18 UTSW 4 132459883 missense probably damaging 0.99
R7556:Med18 UTSW 4 132459936 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CATGATGCCCTTCCGAAACAG -3'
(R):5'- TGACCCTAAATGAAATGAAAGCCG -3'

Sequencing Primer
(F):5'- AAACAGGTGTCCTTTGGCGAC -3'
(R):5'- CTCTTCAGGAAGTGTTTTGGACCAC -3'
Posted On2014-06-30