Incidental Mutation 'R1894:Gcn1l1'
ID211788
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115589115 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 677 (P677L)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably damaging
Transcript: ENSMUST00000064454
AA Change: P677L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: P677L

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141472
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
cusp UTSW 5 115611060 missense probably damaging 1.00
farthing UTSW 5 115576108 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 splice site probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
R7027:Gcn1l1 UTSW 5 115616546 critical splice donor site probably null
R7038:Gcn1l1 UTSW 5 115611144 missense probably damaging 1.00
R7171:Gcn1l1 UTSW 5 115590293 missense probably benign 0.02
R7276:Gcn1l1 UTSW 5 115611060 missense probably damaging 1.00
R7456:Gcn1l1 UTSW 5 115604946 nonsense probably null
R7473:Gcn1l1 UTSW 5 115581804 missense probably benign 0.09
R7517:Gcn1l1 UTSW 5 115619696 missense probably benign 0.01
R7714:Gcn1l1 UTSW 5 115595300 missense probably damaging 0.97
R7752:Gcn1l1 UTSW 5 115615568 missense probably damaging 1.00
R7812:Gcn1l1 UTSW 5 115593692 missense possibly damaging 0.91
R7922:Gcn1l1 UTSW 5 115614468 missense probably benign
R8070:Gcn1l1 UTSW 5 115588998 missense probably benign 0.09
R8218:Gcn1l1 UTSW 5 115581529 missense probably benign 0.00
R8329:Gcn1l1 UTSW 5 115609862 missense probably damaging 0.99
R8413:Gcn1l1 UTSW 5 115579639 missense probably benign 0.00
Z1177:Gcn1l1 UTSW 5 115614149 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTGGGGACATGTTTGTTC -3'
(R):5'- TGATCCTGGGGATGATCTGATCC -3'

Sequencing Primer
(F):5'- CTACAGGTGCTTCCCTTGGAG -3'
(R):5'- GATGATCTGATCCAGGTGCC -3'
Posted On2014-06-30