Mutagenetix > Incidental Mutations

Incidental Mutation 'R1894:Trim24'

211790

Institutional Source

Beutler Lab

Gene Symbol

Trim24

Ensembl Gene

ENSMUSG00000029833

Gene Name

tripartite motif-containing 24

Synonyms

A130082H20Rik, D430004I05Rik, TIF1alpha, Tif1a

MMRRC Submission

039914-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37870811-37966296 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 37957078 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 652 (R652L)

Ref Sequence

ENSEMBL: ENSMUSP00000114001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031859
AA Change: R722L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: R722L

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
RING	52	130	2.5e-10	SMART
BBOX	158	205	2e-13	SMART
BBOX	218	259	7e-14	SMART
BBC	266	392	3e-44	SMART
low complexity region	474	491	N/A	INTRINSIC
low complexity region	501	514	N/A	INTRINSIC
low complexity region	573	598	N/A	INTRINSIC
low complexity region	686	709	N/A	INTRINSIC
low complexity region	759	774	N/A	INTRINSIC
PHD	829	872	2.1e-13	SMART
BROMO	902	1007	2.4e-40	SMART
low complexity region	1025	1033	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120238
AA Change: R652L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: R652L

Domain	Start	End	E-Value	Type
BBOX	88	135	2e-13	SMART
BBOX	148	189	6.8e-14	SMART
BBC	196	322	3e-44	SMART
low complexity region	404	421	N/A	INTRINSIC
low complexity region	431	444	N/A	INTRINSIC
low complexity region	503	528	N/A	INTRINSIC
low complexity region	616	639	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
PHD	759	802	2e-13	SMART
BROMO	832	937	2.4e-40	SMART
low complexity region	955	963	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120428
AA Change: R688L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: R688L

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
RING	52	130	5.22e-8	SMART
BBOX	158	205	6.27e-11	SMART
BBOX	218	259	2.22e-11	SMART
BBC	266	392	5.86e-42	SMART
low complexity region	539	564	N/A	INTRINSIC
low complexity region	652	675	N/A	INTRINSIC
low complexity region	725	740	N/A	INTRINSIC
PHD	795	838	3.15e-11	SMART
BROMO	868	973	3.95e-38	SMART
low complexity region	991	999	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135387

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	T	1: 105,664,576	I157F	probably benign	Het
Adgrb2	T	C	4: 130,013,626	F977S	probably damaging	Het
Ago4	A	G	4: 126,512,600	Y306H	probably benign	Het
Cblc	T	C	7: 19,792,577	T196A	probably damaging	Het
Ccdc109b	T	C	3: 129,934,663	H55R	probably benign	Het
Cfap52	T	A	11: 67,953,619		probably null	Het
Cops3	T	C	11: 59,820,018	N375S	probably benign	Het
Crb1	T	C	1: 139,243,193	T759A	probably benign	Het
Dnah3	T	C	7: 120,086,334	K153E	probably benign	Het
Elovl1	C	T	4: 118,430,748	S27F	probably damaging	Het
Erc2	A	G	14: 28,141,228	E804G	probably damaging	Het
Fam110b	G	T	4: 5,798,840	C86F	probably damaging	Het
Fbn1	T	A	2: 125,394,621	R380W	probably damaging	Het
Gatad2a	C	T	8: 69,916,651	R221Q	probably damaging	Het
Gcn1l1	C	T	5: 115,589,115	P677L	probably damaging	Het
Gm6020	C	T	19: 61,183,953	H22Y	possibly damaging	Het
Gm9817	T	C	13: 45,079,129	V136A	unknown	Het
Gmip	T	A	8: 69,820,972	L971H	probably damaging	Het
Gnptab	G	A	10: 88,419,127	E192K	possibly damaging	Het
Grm7	G	A	6: 111,358,607	V660I	probably benign	Het
Helz2	G	A	2: 181,234,289	P1471S	probably damaging	Het
Herc1	G	A	9: 66,479,461	G3786S	probably damaging	Het
Isg20	T	C	7: 78,919,899	V206A	probably benign	Het
Jund	T	A	8: 70,699,821	I255N	probably damaging	Het
Kcnt2	A	T	1: 140,425,341	I263F	probably damaging	Het
Kif2c	A	T	4: 117,162,223	L561Q	probably benign	Het
Klhl3	T	C	13: 58,009,375	D546G	probably damaging	Het
Klk1b4	A	T	7: 44,209,630	Q24L	probably benign	Het
Ltbp2	A	T	12: 84,787,961	C225S	probably damaging	Het
Mecp2	C	T	X: 74,037,175	A79T	probably damaging	Het
Med18	G	A	4: 132,459,931	R86*	probably null	Het
Mfsd2b	T	C	12: 4,869,155	E63G	probably damaging	Het
Mtus1	C	T	8: 41,084,325	S118N	probably damaging	Het
Mybbp1a	C	T	11: 72,446,037	T565I	probably benign	Het
Myo15b	G	A	11: 115,887,073	G1049S	probably damaging	Het
Nfrkb	T	A	9: 31,414,768	V1169E	probably benign	Het
Nr2f2	T	A	7: 70,354,671	M411L	probably benign	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Nup214	A	T	2: 31,996,380	T585S	possibly damaging	Het
Olfr1025-ps1	C	T	2: 85,918,255	T110I	probably benign	Het
Olfr807	A	T	10: 129,755,074	C125*	probably null	Het
Olfr873	T	C	9: 20,300,337	S47P	probably benign	Het
Olfr875	T	A	9: 37,772,867	D69E	possibly damaging	Het
Pih1d1	T	A	7: 45,157,741	I166N	probably damaging	Het
Prl2c5	T	C	13: 13,191,678	F181L	probably benign	Het
Prx	C	T	7: 27,519,110	T1012I	possibly damaging	Het
Rassf8	T	A	6: 145,808,473	V5E	probably damaging	Het
Rassf9	C	A	10: 102,544,894	R44S	possibly damaging	Het
Sde2	G	A	1: 180,860,008	S153N	probably benign	Het
Sec16b	T	A	1: 157,552,975	M372K	possibly damaging	Het
Sgcd	A	T	11: 47,195,110	I71N	probably damaging	Het
Slco5a1	C	T	1: 12,872,259	C721Y	probably damaging	Het
Slx4ip	A	T	2: 137,068,118	K344N	probably benign	Het
Sorcs3	A	T	19: 48,794,274	Q1076L	probably benign	Het
Spata21	A	T	4: 141,111,381	N581I	possibly damaging	Het
Spata31d1d	G	T	13: 59,728,122	P533H	probably benign	Het
Spice1	T	G	16: 44,365,626	S111A	probably damaging	Het
Tex14	T	G	11: 87,474,448	F61V	probably damaging	Het
Timp3	C	T	10: 86,345,852	R196*	probably null	Het
Tll2	A	G	19: 41,088,671		probably null	Het
Tppp	A	G	13: 74,021,207	D22G	possibly damaging	Het
Uaca	T	C	9: 60,870,436	S702P	possibly damaging	Het
Uggt2	T	C	14: 119,049,718	E146G	probably damaging	Het
Vmn1r233	T	C	17: 20,993,732	S319G	probably benign	Het
Wdr47	A	T	3: 108,623,376	Q395L	possibly damaging	Het
Wrnip1	A	G	13: 32,805,336		probably null	Het
Zfp420	A	T	7: 29,874,508	H51L	probably damaging	Het

Other mutations in Trim24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Trim24	APN	6	37903648	missense	possibly damaging	0.76
IGL01307:Trim24	APN	6	37965635	missense	possibly damaging	0.81
IGL01790:Trim24	APN	6	37945613	missense	probably benign
IGL02525:Trim24	APN	6	37945718	missense	probably damaging	0.99
IGL02557:Trim24	APN	6	37965499	critical splice acceptor site	probably null
IGL02671:Trim24	APN	6	37960784	missense	probably damaging	1.00
IGL02795:Trim24	APN	6	37919389	missense	probably damaging	1.00
IGL02877:Trim24	APN	6	37965646	missense	probably damaging	1.00
IGL02889:Trim24	APN	6	37957761	missense	probably benign	0.02
IGL02930:Trim24	APN	6	37951445	splice site	probably benign
IGL03076:Trim24	APN	6	37965632	missense	probably damaging	0.98
accomodating	UTSW	6	37919397	missense	probably damaging	1.00
Lithe	UTSW	6	37958569	missense	probably damaging	1.00
Nervous	UTSW	6	37957729	missense	probably damaging	1.00
pliant	UTSW	6	37919491	critical splice donor site	probably null
qualmish	UTSW	6	37903652	critical splice donor site	probably null
Queasy	UTSW	6	37908305	missense	probably damaging	0.99
squeamish	UTSW	6	37915202	nonsense	probably null
uneasy	UTSW	6	37956477	critical splice donor site	probably null
PIT4651001:Trim24	UTSW	6	37900732	critical splice donor site	probably null
R0037:Trim24	UTSW	6	37957549	missense	probably damaging	1.00
R0037:Trim24	UTSW	6	37957549	missense	probably damaging	1.00
R0183:Trim24	UTSW	6	37943480	missense	possibly damaging	0.90
R0471:Trim24	UTSW	6	37915195	missense	possibly damaging	0.94
R0485:Trim24	UTSW	6	37957066	missense	probably damaging	1.00
R0606:Trim24	UTSW	6	37871234	missense	probably benign
R0609:Trim24	UTSW	6	37957783	missense	probably damaging	1.00
R0637:Trim24	UTSW	6	37958559	splice site	probably null
R0734:Trim24	UTSW	6	37919465	missense	possibly damaging	0.86
R0855:Trim24	UTSW	6	37915202	nonsense	probably null
R1131:Trim24	UTSW	6	37957782	missense	probably damaging	1.00
R1141:Trim24	UTSW	6	37915293	missense	probably damaging	1.00
R1159:Trim24	UTSW	6	37956477	critical splice donor site	probably null
R1460:Trim24	UTSW	6	37964826	missense	probably damaging	1.00
R1672:Trim24	UTSW	6	37915279	missense	probably damaging	1.00
R1868:Trim24	UTSW	6	37951512	missense	probably damaging	0.99
R1888:Trim24	UTSW	6	37957078	missense	probably damaging	0.99
R1888:Trim24	UTSW	6	37957078	missense	probably damaging	0.99
R1913:Trim24	UTSW	6	37957815	missense	probably damaging	1.00
R2254:Trim24	UTSW	6	37958677	missense	probably benign
R2511:Trim24	UTSW	6	37903652	critical splice donor site	probably null
R2849:Trim24	UTSW	6	37956453	missense	probably damaging	0.99
R3878:Trim24	UTSW	6	37964773	missense	probably benign	0.14
R4084:Trim24	UTSW	6	37915257	missense	probably damaging	1.00
R4235:Trim24	UTSW	6	37964740	missense	probably damaging	1.00
R4292:Trim24	UTSW	6	37900692	missense	possibly damaging	0.91
R4633:Trim24	UTSW	6	37956436	missense	probably damaging	0.98
R4651:Trim24	UTSW	6	37957839	critical splice donor site	probably null
R4652:Trim24	UTSW	6	37957839	critical splice donor site	probably null
R4686:Trim24	UTSW	6	37908305	missense	probably damaging	0.99
R5000:Trim24	UTSW	6	37958612	missense	probably benign	0.01
R5213:Trim24	UTSW	6	37957075	missense	probably damaging	0.99
R5258:Trim24	UTSW	6	37919400	missense	probably damaging	0.99
R5292:Trim24	UTSW	6	37903604	missense	probably benign	0.23
R5395:Trim24	UTSW	6	37957744	missense	probably damaging	1.00
R5547:Trim24	UTSW	6	37965550	missense	probably damaging	1.00
R5666:Trim24	UTSW	6	37965601	missense	probably benign	0.19
R5670:Trim24	UTSW	6	37965601	missense	probably benign	0.19
R5849:Trim24	UTSW	6	37957729	missense	probably damaging	1.00
R5927:Trim24	UTSW	6	37958569	missense	probably damaging	1.00
R5932:Trim24	UTSW	6	37957075	missense	probably damaging	0.99
R6286:Trim24	UTSW	6	37919491	critical splice donor site	probably null
R6374:Trim24	UTSW	6	37953549	missense	probably benign	0.12
R6449:Trim24	UTSW	6	37903652	critical splice donor site	probably null
R6723:Trim24	UTSW	6	37951468	missense	probably benign	0.00
R6731:Trim24	UTSW	6	37943485	missense	probably damaging	0.99
R6975:Trim24	UTSW	6	37919492	critical splice donor site	probably null
R7000:Trim24	UTSW	6	37958678	missense	probably benign	0.24
R7067:Trim24	UTSW	6	37957840	splice site	probably null
R7126:Trim24	UTSW	6	37919457	missense	probably damaging	1.00
R7162:Trim24	UTSW	6	37965521	missense	possibly damaging	0.68
R7486:Trim24	UTSW	6	37957839	critical splice donor site	probably null
R7779:Trim24	UTSW	6	37919397	missense	probably damaging	1.00
R7779:Trim24	UTSW	6	37919398	missense	probably damaging	0.99
R8070:Trim24	UTSW	6	37957726	missense	probably damaging	0.99
R8096:Trim24	UTSW	6	37958657	missense	probably benign	0.03
R8184:Trim24	UTSW	6	37871307	missense	probably damaging	1.00
R8323:Trim24	UTSW	6	37915298	critical splice donor site	probably null
R8476:Trim24	UTSW	6	37945643	nonsense	probably null
RF007:Trim24	UTSW	6	37953536	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACGTTACTATTGTGAAGTGGCAG -3'
(R):5'- CAGTGTGGAAGTCAATGCAG -3'

Sequencing Primer
(F):5'- GGCAGTATTCCAGAATGTTCTTCAG -3'
(R):5'- TTGACACAATCTGGAGCCATG -3'

Posted On

2014-06-30