Mutagenetix > Incidental Mutations

Incidental Mutation 'R1894:Rassf8'

211794

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

MMRRC Submission

039914-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.792) question?

Stock #

R1894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 145808473 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 5 (V5E)

Ref Sequence

ENSEMBL: ENSMUSP00000122684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032388
AA Change: V5E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: V5E

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111704
AA Change: V5E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: V5E

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140966
AA Change: V5E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259
AA Change: V5E

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	T	1: 105,664,576	I157F	probably benign	Het
Adgrb2	T	C	4: 130,013,626	F977S	probably damaging	Het
Ago4	A	G	4: 126,512,600	Y306H	probably benign	Het
Cblc	T	C	7: 19,792,577	T196A	probably damaging	Het
Ccdc109b	T	C	3: 129,934,663	H55R	probably benign	Het
Cfap52	T	A	11: 67,953,619		probably null	Het
Cops3	T	C	11: 59,820,018	N375S	probably benign	Het
Crb1	T	C	1: 139,243,193	T759A	probably benign	Het
Dnah3	T	C	7: 120,086,334	K153E	probably benign	Het
Elovl1	C	T	4: 118,430,748	S27F	probably damaging	Het
Erc2	A	G	14: 28,141,228	E804G	probably damaging	Het
Fam110b	G	T	4: 5,798,840	C86F	probably damaging	Het
Fbn1	T	A	2: 125,394,621	R380W	probably damaging	Het
Gatad2a	C	T	8: 69,916,651	R221Q	probably damaging	Het
Gcn1l1	C	T	5: 115,589,115	P677L	probably damaging	Het
Gm6020	C	T	19: 61,183,953	H22Y	possibly damaging	Het
Gm9817	T	C	13: 45,079,129	V136A	unknown	Het
Gmip	T	A	8: 69,820,972	L971H	probably damaging	Het
Gnptab	G	A	10: 88,419,127	E192K	possibly damaging	Het
Grm7	G	A	6: 111,358,607	V660I	probably benign	Het
Helz2	G	A	2: 181,234,289	P1471S	probably damaging	Het
Herc1	G	A	9: 66,479,461	G3786S	probably damaging	Het
Isg20	T	C	7: 78,919,899	V206A	probably benign	Het
Jund	T	A	8: 70,699,821	I255N	probably damaging	Het
Kcnt2	A	T	1: 140,425,341	I263F	probably damaging	Het
Kif2c	A	T	4: 117,162,223	L561Q	probably benign	Het
Klhl3	T	C	13: 58,009,375	D546G	probably damaging	Het
Klk1b4	A	T	7: 44,209,630	Q24L	probably benign	Het
Ltbp2	A	T	12: 84,787,961	C225S	probably damaging	Het
Mecp2	C	T	X: 74,037,175	A79T	probably damaging	Het
Med18	G	A	4: 132,459,931	R86*	probably null	Het
Mfsd2b	T	C	12: 4,869,155	E63G	probably damaging	Het
Mtus1	C	T	8: 41,084,325	S118N	probably damaging	Het
Mybbp1a	C	T	11: 72,446,037	T565I	probably benign	Het
Myo15b	G	A	11: 115,887,073	G1049S	probably damaging	Het
Nfrkb	T	A	9: 31,414,768	V1169E	probably benign	Het
Nr2f2	T	A	7: 70,354,671	M411L	probably benign	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Nup214	A	T	2: 31,996,380	T585S	possibly damaging	Het
Olfr1025-ps1	C	T	2: 85,918,255	T110I	probably benign	Het
Olfr807	A	T	10: 129,755,074	C125*	probably null	Het
Olfr873	T	C	9: 20,300,337	S47P	probably benign	Het
Olfr875	T	A	9: 37,772,867	D69E	possibly damaging	Het
Pih1d1	T	A	7: 45,157,741	I166N	probably damaging	Het
Prl2c5	T	C	13: 13,191,678	F181L	probably benign	Het
Prx	C	T	7: 27,519,110	T1012I	possibly damaging	Het
Rassf9	C	A	10: 102,544,894	R44S	possibly damaging	Het
Sde2	G	A	1: 180,860,008	S153N	probably benign	Het
Sec16b	T	A	1: 157,552,975	M372K	possibly damaging	Het
Sgcd	A	T	11: 47,195,110	I71N	probably damaging	Het
Slco5a1	C	T	1: 12,872,259	C721Y	probably damaging	Het
Slx4ip	A	T	2: 137,068,118	K344N	probably benign	Het
Sorcs3	A	T	19: 48,794,274	Q1076L	probably benign	Het
Spata21	A	T	4: 141,111,381	N581I	possibly damaging	Het
Spata31d1d	G	T	13: 59,728,122	P533H	probably benign	Het
Spice1	T	G	16: 44,365,626	S111A	probably damaging	Het
Tex14	T	G	11: 87,474,448	F61V	probably damaging	Het
Timp3	C	T	10: 86,345,852	R196*	probably null	Het
Tll2	A	G	19: 41,088,671		probably null	Het
Tppp	A	G	13: 74,021,207	D22G	possibly damaging	Het
Trim24	G	T	6: 37,957,078	R652L	probably damaging	Het
Uaca	T	C	9: 60,870,436	S702P	possibly damaging	Het
Uggt2	T	C	14: 119,049,718	E146G	probably damaging	Het
Vmn1r233	T	C	17: 20,993,732	S319G	probably benign	Het
Wdr47	A	T	3: 108,623,376	Q395L	possibly damaging	Het
Wrnip1	A	G	13: 32,805,336		probably null	Het
Zfp420	A	T	7: 29,874,508	H51L	probably damaging	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1429:Rassf8	UTSW	6	145815190	missense	probably damaging	1.00
R1622:Rassf8	UTSW	6	145820103	unclassified	probably benign
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2238:Rassf8	UTSW	6	145817184	missense	probably damaging	1.00
R2439:Rassf8	UTSW	6	145815334	missense	probably damaging	1.00
R3699:Rassf8	UTSW	6	145820076	unclassified	probably benign
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7714:Rassf8	UTSW	6	145815247	missense	probably damaging	0.98
R7962:Rassf8	UTSW	6	145815943	critical splice donor site	probably null
R8222:Rassf8	UTSW	6	145820057	missense	unknown
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCACAGTGGGATGCTTCTTG -3'
(R):5'- TGCTGAGGTAGTTCACACAC -3'

Sequencing Primer
(F):5'- ATGCTTCTTGTTGTGTTATAGTTCAC -3'
(R):5'- TGAGGTAGTTCACACACACACAC -3'

Posted On

2014-06-30