Mutagenetix > Incidental Mutations

Incidental Mutation 'R1894:Prx'

211797

Institutional Source

Beutler Lab

Gene Symbol

Prx

Ensembl Gene

ENSMUSG00000053198

Gene Name

periaxin

Synonyms

L-Periaxin

MMRRC Submission

039914-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27499324-27520214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 27519110 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1012 (T1012I)

Ref Sequence

ENSEMBL: ENSMUSP00000145598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108353] [ENSMUST00000108355] [ENSMUST00000125990]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065487
AA Change: T1151I

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: T1151I

Domain	Start	End	E-Value	Type
PDZ	28	100	6.83e-8	SMART
low complexity region	179	232	N/A	INTRINSIC
low complexity region	267	289	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
internal_repeat_3	316	419	9.05e-5	PROSPERO
internal_repeat_2	317	428	7.28e-6	PROSPERO
internal_repeat_1	321	508	8.09e-9	PROSPERO
internal_repeat_1	503	779	8.09e-9	PROSPERO
internal_repeat_2	840	974	7.28e-6	PROSPERO
internal_repeat_3	1176	1268	9.05e-5	PROSPERO
low complexity region	1275	1314	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098644
AA Change: T1151I

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: T1151I

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
PDZ	28	100	6.83e-8	SMART
low complexity region	179	232	N/A	INTRINSIC
low complexity region	267	289	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
internal_repeat_3	316	419	5.13e-5	PROSPERO
internal_repeat_2	317	428	3.79e-6	PROSPERO
internal_repeat_1	321	508	3.34e-9	PROSPERO
internal_repeat_1	503	779	3.34e-9	PROSPERO
internal_repeat_2	840	974	3.79e-6	PROSPERO
internal_repeat_3	1176	1268	5.13e-5	PROSPERO
low complexity region	1275	1314	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108353

SMART Domains

Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424

Domain	Start	End	E-Value	Type
S_TKc	11	347	9.31e-74	SMART
low complexity region	396	410	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108355

SMART Domains

Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
PDZ	28	100	6.83e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125990
AA Change: T1012I

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	T	1: 105,664,576	I157F	probably benign	Het
Adgrb2	T	C	4: 130,013,626	F977S	probably damaging	Het
Ago4	A	G	4: 126,512,600	Y306H	probably benign	Het
Cblc	T	C	7: 19,792,577	T196A	probably damaging	Het
Ccdc109b	T	C	3: 129,934,663	H55R	probably benign	Het
Cfap52	T	A	11: 67,953,619		probably null	Het
Cops3	T	C	11: 59,820,018	N375S	probably benign	Het
Crb1	T	C	1: 139,243,193	T759A	probably benign	Het
Dnah3	T	C	7: 120,086,334	K153E	probably benign	Het
Elovl1	C	T	4: 118,430,748	S27F	probably damaging	Het
Erc2	A	G	14: 28,141,228	E804G	probably damaging	Het
Fam110b	G	T	4: 5,798,840	C86F	probably damaging	Het
Fbn1	T	A	2: 125,394,621	R380W	probably damaging	Het
Gatad2a	C	T	8: 69,916,651	R221Q	probably damaging	Het
Gcn1l1	C	T	5: 115,589,115	P677L	probably damaging	Het
Gm6020	C	T	19: 61,183,953	H22Y	possibly damaging	Het
Gm9817	T	C	13: 45,079,129	V136A	unknown	Het
Gmip	T	A	8: 69,820,972	L971H	probably damaging	Het
Gnptab	G	A	10: 88,419,127	E192K	possibly damaging	Het
Grm7	G	A	6: 111,358,607	V660I	probably benign	Het
Helz2	G	A	2: 181,234,289	P1471S	probably damaging	Het
Herc1	G	A	9: 66,479,461	G3786S	probably damaging	Het
Isg20	T	C	7: 78,919,899	V206A	probably benign	Het
Jund	T	A	8: 70,699,821	I255N	probably damaging	Het
Kcnt2	A	T	1: 140,425,341	I263F	probably damaging	Het
Kif2c	A	T	4: 117,162,223	L561Q	probably benign	Het
Klhl3	T	C	13: 58,009,375	D546G	probably damaging	Het
Klk1b4	A	T	7: 44,209,630	Q24L	probably benign	Het
Ltbp2	A	T	12: 84,787,961	C225S	probably damaging	Het
Mecp2	C	T	X: 74,037,175	A79T	probably damaging	Het
Med18	G	A	4: 132,459,931	R86*	probably null	Het
Mfsd2b	T	C	12: 4,869,155	E63G	probably damaging	Het
Mtus1	C	T	8: 41,084,325	S118N	probably damaging	Het
Mybbp1a	C	T	11: 72,446,037	T565I	probably benign	Het
Myo15b	G	A	11: 115,887,073	G1049S	probably damaging	Het
Nfrkb	T	A	9: 31,414,768	V1169E	probably benign	Het
Nr2f2	T	A	7: 70,354,671	M411L	probably benign	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Nup214	A	T	2: 31,996,380	T585S	possibly damaging	Het
Olfr1025-ps1	C	T	2: 85,918,255	T110I	probably benign	Het
Olfr807	A	T	10: 129,755,074	C125*	probably null	Het
Olfr873	T	C	9: 20,300,337	S47P	probably benign	Het
Olfr875	T	A	9: 37,772,867	D69E	possibly damaging	Het
Pih1d1	T	A	7: 45,157,741	I166N	probably damaging	Het
Prl2c5	T	C	13: 13,191,678	F181L	probably benign	Het
Rassf8	T	A	6: 145,808,473	V5E	probably damaging	Het
Rassf9	C	A	10: 102,544,894	R44S	possibly damaging	Het
Sde2	G	A	1: 180,860,008	S153N	probably benign	Het
Sec16b	T	A	1: 157,552,975	M372K	possibly damaging	Het
Sgcd	A	T	11: 47,195,110	I71N	probably damaging	Het
Slco5a1	C	T	1: 12,872,259	C721Y	probably damaging	Het
Slx4ip	A	T	2: 137,068,118	K344N	probably benign	Het
Sorcs3	A	T	19: 48,794,274	Q1076L	probably benign	Het
Spata21	A	T	4: 141,111,381	N581I	possibly damaging	Het
Spata31d1d	G	T	13: 59,728,122	P533H	probably benign	Het
Spice1	T	G	16: 44,365,626	S111A	probably damaging	Het
Tex14	T	G	11: 87,474,448	F61V	probably damaging	Het
Timp3	C	T	10: 86,345,852	R196*	probably null	Het
Tll2	A	G	19: 41,088,671		probably null	Het
Tppp	A	G	13: 74,021,207	D22G	possibly damaging	Het
Trim24	G	T	6: 37,957,078	R652L	probably damaging	Het
Uaca	T	C	9: 60,870,436	S702P	possibly damaging	Het
Uggt2	T	C	14: 119,049,718	E146G	probably damaging	Het
Vmn1r233	T	C	17: 20,993,732	S319G	probably benign	Het
Wdr47	A	T	3: 108,623,376	Q395L	possibly damaging	Het
Wrnip1	A	G	13: 32,805,336		probably null	Het
Zfp420	A	T	7: 29,874,508	H51L	probably damaging	Het

Other mutations in Prx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Prx	APN	7	27519419	missense	probably benign	0.12
IGL01702:Prx	APN	7	27519787	missense	probably benign	0.00
IGL02012:Prx	APN	7	27517901	missense	probably damaging	1.00
IGL02214:Prx	APN	7	27518912	missense	probably damaging	1.00
IGL02498:Prx	APN	7	27518072	missense	probably damaging	1.00
IGL03029:Prx	APN	7	27508061	nonsense	probably null
R0522:Prx	UTSW	7	27518195	missense	probably damaging	0.99
R0655:Prx	UTSW	7	27517421	missense	probably damaging	1.00
R0904:Prx	UTSW	7	27518294	missense	probably damaging	1.00
R1161:Prx	UTSW	7	27519677	missense	probably damaging	1.00
R1170:Prx	UTSW	7	27518007	nonsense	probably null
R1270:Prx	UTSW	7	27518930	missense	probably damaging	0.96
R1470:Prx	UTSW	7	27517601	missense	probably benign	0.19
R1470:Prx	UTSW	7	27517601	missense	probably benign	0.19
R1536:Prx	UTSW	7	27517258	missense	probably damaging	0.99
R1721:Prx	UTSW	7	27517523	missense	probably benign	0.19
R1815:Prx	UTSW	7	27516665	missense	probably damaging	1.00
R1848:Prx	UTSW	7	27518888	missense	possibly damaging	0.70
R2179:Prx	UTSW	7	27517985	missense	probably benign
R2207:Prx	UTSW	7	27516788	missense	probably damaging	1.00
R2312:Prx	UTSW	7	27516626	missense	possibly damaging	0.87
R2356:Prx	UTSW	7	27507859	start gained	probably benign
R2519:Prx	UTSW	7	27518243	missense	probably benign	0.43
R2912:Prx	UTSW	7	27516229	missense	probably damaging	1.00
R4717:Prx	UTSW	7	27516727	missense	probably benign	0.07
R4868:Prx	UTSW	7	27517579	missense	probably benign	0.01
R5153:Prx	UTSW	7	27518476	missense	probably damaging	1.00
R5418:Prx	UTSW	7	27517274	missense	probably damaging	0.99
R5653:Prx	UTSW	7	27517604	missense	probably damaging	1.00
R5895:Prx	UTSW	7	27515284	missense	probably damaging	1.00
R6022:Prx	UTSW	7	27517573	missense	probably damaging	1.00
R6112:Prx	UTSW	7	27516548	missense	probably damaging	1.00
R6223:Prx	UTSW	7	27516836	missense	probably damaging	1.00
R6560:Prx	UTSW	7	27515321	missense	probably damaging	1.00
R6888:Prx	UTSW	7	27519634	missense	possibly damaging	0.73
R7530:Prx	UTSW	7	27507972	missense	probably damaging	1.00
R7854:Prx	UTSW	7	27516641	missense	probably damaging	1.00
R8258:Prx	UTSW	7	27519383	missense	probably damaging	1.00
R8259:Prx	UTSW	7	27519383	missense	probably damaging	1.00
RF009:Prx	UTSW	7	27518960	missense	probably damaging	1.00
X0028:Prx	UTSW	7	27517733	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGGTATCTCTTTGCCCCAGGTG -3'
(R):5'- TACTCAGCGTGGCTACTCAC -3'

Sequencing Primer
(F):5'- CTCTTTGCCCCAGGTGGAATTG -3'
(R):5'- TGAGTTCCACATCGGGCAATG -3'

Posted On

2014-06-30