Incidental Mutation 'R1894:Ltbp2'
ID211831
Institutional Source Beutler Lab
Gene Symbol Ltbp2
Ensembl Gene ENSMUSG00000002020
Gene Namelatent transforming growth factor beta binding protein 2
Synonyms
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84783212-84876532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84787961 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 225 (C225S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002073] [ENSMUST00000110254] [ENSMUST00000163189] [ENSMUST00000166383]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002073
AA Change: C1426S

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020
AA Change: C1426S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 546 582 3.8e-9 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 666 707 3.4e-17 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 917 1.75e-10 SMART
EGF_CA 918 957 1.53e-10 SMART
EGF_CA 958 997 3.51e-10 SMART
EGF_CA 998 1038 8.3e-12 SMART
EGF_CA 1039 1080 4.56e-9 SMART
EGF_CA 1081 1122 4.56e-9 SMART
EGF_CA 1123 1163 8.76e-11 SMART
EGF_CA 1164 1205 4.38e-11 SMART
EGF_CA 1206 1246 1.75e-10 SMART
EGF_CA 1247 1290 2.24e-8 SMART
EGF_CA 1291 1332 6.01e-9 SMART
EGF 1336 1375 1.95e1 SMART
Pfam:TB 1410 1450 1.4e-13 PFAM
EGF_CA 1473 1515 2.31e-10 SMART
EGF_CA 1516 1555 7.93e-9 SMART
Pfam:TB 1582 1623 1e-13 PFAM
low complexity region 1691 1704 N/A INTRINSIC
EGF 1724 1761 4e-5 SMART
EGF_CA 1762 1806 1.91e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110254
AA Change: C1403S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020
AA Change: C1403S

DomainStartEndE-ValueType
low complexity region 119 128 N/A INTRINSIC
EGF 204 233 6.55e-1 SMART
low complexity region 275 295 N/A INTRINSIC
EGF 404 433 8.19e-2 SMART
low complexity region 535 546 N/A INTRINSIC
Pfam:TB 565 602 4e-8 PFAM
EGF_CA 626 666 8.05e-10 SMART
Pfam:TB 685 727 3.7e-16 PFAM
EGF_CA 852 894 7.18e-7 SMART
EGF_CA 895 934 1.53e-10 SMART
EGF_CA 935 974 3.51e-10 SMART
EGF_CA 975 1015 8.3e-12 SMART
EGF_CA 1016 1057 4.56e-9 SMART
EGF_CA 1058 1099 4.56e-9 SMART
EGF_CA 1100 1140 8.76e-11 SMART
EGF_CA 1141 1182 4.38e-11 SMART
EGF_CA 1183 1223 1.75e-10 SMART
EGF_CA 1224 1267 2.24e-8 SMART
EGF_CA 1268 1309 6.01e-9 SMART
EGF 1313 1352 1.95e1 SMART
Pfam:TB 1387 1427 1.4e-11 PFAM
EGF_CA 1450 1492 2.31e-10 SMART
EGF_CA 1493 1532 7.93e-9 SMART
Pfam:TB 1558 1600 4.6e-13 PFAM
low complexity region 1668 1681 N/A INTRINSIC
EGF 1701 1738 4e-5 SMART
EGF_CA 1739 1783 1.91e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163189
AA Change: C1383S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020
AA Change: C1383S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 545 582 4e-8 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 665 707 3.8e-16 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 914 1.53e-10 SMART
EGF_CA 915 954 3.51e-10 SMART
EGF_CA 955 995 8.3e-12 SMART
EGF_CA 996 1037 4.56e-9 SMART
EGF_CA 1038 1079 4.56e-9 SMART
EGF_CA 1080 1120 8.76e-11 SMART
EGF_CA 1121 1162 4.38e-11 SMART
EGF_CA 1163 1203 1.75e-10 SMART
EGF_CA 1204 1247 2.24e-8 SMART
EGF_CA 1248 1289 6.01e-9 SMART
EGF 1293 1332 1.95e1 SMART
Pfam:TB 1367 1407 1.5e-11 PFAM
EGF_CA 1430 1472 2.31e-10 SMART
EGF_CA 1473 1512 7.93e-9 SMART
Pfam:TB 1538 1580 4.7e-13 PFAM
low complexity region 1648 1661 N/A INTRINSIC
EGF 1681 1718 4e-5 SMART
EGF_CA 1719 1763 1.91e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163214
AA Change: C225S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132067
Gene: ENSMUSG00000002020
AA Change: C225S

DomainStartEndE-ValueType
EGF_CA 6 46 8.76e-11 SMART
EGF_CA 47 90 2.24e-8 SMART
EGF_CA 91 132 6.01e-9 SMART
EGF 136 175 1.95e1 SMART
Pfam:TB 210 250 1.5e-14 PFAM
EGF 276 307 1.5e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165141
SMART Domains Protein: ENSMUSP00000132690
Gene: ENSMUSG00000002020

DomainStartEndE-ValueType
EGF 1 31 1.2e1 SMART
EGF_CA 32 71 3.51e-10 SMART
EGF_CA 72 112 8.3e-12 SMART
EGF_CA 113 154 4.56e-9 SMART
EGF_like 155 183 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166383
SMART Domains Protein: ENSMUSP00000127255
Gene: ENSMUSG00000002020

DomainStartEndE-ValueType
EGF_CA 8 49 2.13e-9 SMART
Pfam:TB 75 117 1.3e-14 PFAM
low complexity region 185 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early embryonic lethality prior to E6.5. Mice homozygous for a different null allele are viable, fertile, and developmentally normal but develop lens dislocations due to ciliary zonule fragmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Ltbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Ltbp2 APN 12 84791064 missense probably damaging 1.00
IGL00938:Ltbp2 APN 12 84831799 missense probably benign 0.03
IGL01397:Ltbp2 APN 12 84790268 missense probably damaging 1.00
IGL01570:Ltbp2 APN 12 84794033 missense probably benign 0.05
IGL01631:Ltbp2 APN 12 84809146 critical splice donor site probably null
IGL01662:Ltbp2 APN 12 84809246 missense probably benign 0.00
IGL01728:Ltbp2 APN 12 84791009 missense probably damaging 0.99
IGL01839:Ltbp2 APN 12 84793658 missense possibly damaging 0.48
IGL01946:Ltbp2 APN 12 84830748 missense probably damaging 1.00
IGL01977:Ltbp2 APN 12 84830199 missense probably damaging 1.00
IGL02220:Ltbp2 APN 12 84829309 missense possibly damaging 0.93
IGL02340:Ltbp2 APN 12 84792955 critical splice donor site probably null
IGL02430:Ltbp2 APN 12 84799401 missense probably damaging 1.00
IGL02492:Ltbp2 APN 12 84809665 missense probably damaging 1.00
IGL02517:Ltbp2 APN 12 84785317 missense probably benign 0.42
IGL02794:Ltbp2 APN 12 84791935 missense probably damaging 1.00
deft UTSW 12 84853912 missense probably damaging 0.98
R0045:Ltbp2 UTSW 12 84809587 missense probably damaging 1.00
R0045:Ltbp2 UTSW 12 84813288 missense probably damaging 1.00
R0091:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R0094:Ltbp2 UTSW 12 84799426 missense probably damaging 1.00
R0166:Ltbp2 UTSW 12 84786358 missense probably benign 0.28
R0265:Ltbp2 UTSW 12 84785969 splice site probably null
R0394:Ltbp2 UTSW 12 84806424 splice site probably benign
R0535:Ltbp2 UTSW 12 84784858 missense probably damaging 1.00
R0535:Ltbp2 UTSW 12 84791052 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1513:Ltbp2 UTSW 12 84791944 missense probably damaging 1.00
R1858:Ltbp2 UTSW 12 84830781 nonsense probably null
R1880:Ltbp2 UTSW 12 84829271 missense probably benign 0.45
R1900:Ltbp2 UTSW 12 84830658 missense probably damaging 1.00
R1903:Ltbp2 UTSW 12 84830105 missense probably benign 0.01
R1912:Ltbp2 UTSW 12 84785863 missense probably damaging 0.98
R1993:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R1995:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R2069:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R2126:Ltbp2 UTSW 12 84785709 splice site probably null
R2139:Ltbp2 UTSW 12 84815979 missense probably damaging 1.00
R2341:Ltbp2 UTSW 12 84809163 missense probably benign 0.08
R2511:Ltbp2 UTSW 12 84804409 splice site probably null
R3737:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3738:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3739:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3889:Ltbp2 UTSW 12 84784907 unclassified probably benign
R4034:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R4542:Ltbp2 UTSW 12 84831819 nonsense probably null
R4621:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4623:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4831:Ltbp2 UTSW 12 84793640 missense possibly damaging 0.55
R5080:Ltbp2 UTSW 12 84803864 missense probably damaging 1.00
R5116:Ltbp2 UTSW 12 84809737 missense probably damaging 1.00
R5351:Ltbp2 UTSW 12 84790358 missense possibly damaging 0.95
R5445:Ltbp2 UTSW 12 84809654 missense probably null 1.00
R5608:Ltbp2 UTSW 12 84787464 splice site probably null
R5784:Ltbp2 UTSW 12 84868739 missense probably damaging 1.00
R5838:Ltbp2 UTSW 12 84789101 missense probably benign 0.16
R5859:Ltbp2 UTSW 12 84794063 missense possibly damaging 0.52
R6004:Ltbp2 UTSW 12 84876149 missense probably benign 0.00
R6028:Ltbp2 UTSW 12 84784852 missense probably damaging 1.00
R6347:Ltbp2 UTSW 12 84853912 missense probably damaging 0.98
R6615:Ltbp2 UTSW 12 84813317 missense probably damaging 1.00
R6636:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6637:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6755:Ltbp2 UTSW 12 84795073 missense probably damaging 1.00
R6759:Ltbp2 UTSW 12 84787410 missense probably damaging 0.99
R6806:Ltbp2 UTSW 12 84809238 missense possibly damaging 0.74
R6968:Ltbp2 UTSW 12 84789083 critical splice donor site probably null
R7084:Ltbp2 UTSW 12 84868685 missense probably damaging 1.00
R7250:Ltbp2 UTSW 12 84787392 nonsense probably null
R7374:Ltbp2 UTSW 12 84830175 missense probably damaging 1.00
R7501:Ltbp2 UTSW 12 84830645 missense probably damaging 1.00
R7523:Ltbp2 UTSW 12 84791034 missense probably benign 0.00
R7754:Ltbp2 UTSW 12 84813238 critical splice donor site probably null
R7827:Ltbp2 UTSW 12 84789881 missense probably benign 0.19
R8042:Ltbp2 UTSW 12 84791899 missense probably damaging 0.99
R8110:Ltbp2 UTSW 12 84803902 nonsense probably null
R8411:Ltbp2 UTSW 12 84786413 missense probably damaging 1.00
X0017:Ltbp2 UTSW 12 84828528 missense probably damaging 1.00
X0026:Ltbp2 UTSW 12 84830199 missense probably damaging 1.00
Z1176:Ltbp2 UTSW 12 84875853 missense probably benign 0.01
Z1177:Ltbp2 UTSW 12 84829316 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAACATGTCATGTCTCCCTACC -3'
(R):5'- GCCTCAAAGGGTCATGAACAG -3'

Sequencing Primer
(F):5'- GTTGGCCTTGAACTCACAAG -3'
(R):5'- ACAGACTGTCATAGGGGGCTTC -3'
Posted On2014-06-30