Incidental Mutation 'R1894:Erc2'
ID211839
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene NameELKS/RAB6-interacting/CAST family member 2
SynonymsELKS2alpha, D14Ertd171e
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27622428-28478537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28141228 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 804 (E804G)
Ref Sequence ENSEMBL: ENSMUSP00000147886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]
Predicted Effect probably damaging
Transcript: ENSMUST00000090302
AA Change: E800G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: E800G

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209800
Predicted Effect probably damaging
Transcript: ENSMUST00000210135
AA Change: E824G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000210924
AA Change: E470G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211145
AA Change: E804G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 28040521 missense probably damaging 0.98
IGL01862:Erc2 APN 14 28271569 splice site probably benign
IGL01906:Erc2 APN 14 28141306 missense probably damaging 0.99
IGL02177:Erc2 APN 14 27898623 missense probably benign 0.00
IGL02481:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02483:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02623:Erc2 APN 14 27776980 missense probably damaging 1.00
IGL03252:Erc2 APN 14 28475649 utr 3 prime probably benign
IGL03378:Erc2 APN 14 28011723 missense probably damaging 1.00
lobe UTSW 14 28317251 missense probably damaging 0.96
R0091:Erc2 UTSW 14 27776824 critical splice acceptor site probably null
R0309:Erc2 UTSW 14 28141225 missense probably damaging 0.98
R0357:Erc2 UTSW 14 27777022 missense probably damaging 0.99
R0378:Erc2 UTSW 14 28011694 missense probably damaging 1.00
R0550:Erc2 UTSW 14 28271651 missense possibly damaging 0.74
R0815:Erc2 UTSW 14 28025148 missense probably benign 0.04
R0863:Erc2 UTSW 14 28025148 missense probably benign 0.04
R1121:Erc2 UTSW 14 28475655 utr 3 prime probably benign
R1164:Erc2 UTSW 14 28302972 missense probably damaging 0.99
R1498:Erc2 UTSW 14 28302898 missense probably benign 0.27
R1500:Erc2 UTSW 14 28271660 missense probably damaging 0.98
R1555:Erc2 UTSW 14 28011665 missense probably damaging 0.99
R1950:Erc2 UTSW 14 27912900 missense probably damaging 0.99
R1991:Erc2 UTSW 14 28011636 missense probably benign 0.34
R2698:Erc2 UTSW 14 28271705 missense probably benign 0.06
R2847:Erc2 UTSW 14 28040488 missense probably damaging 0.97
R3015:Erc2 UTSW 14 28011775 critical splice donor site probably null
R3612:Erc2 UTSW 14 27777177 missense possibly damaging 0.69
R3759:Erc2 UTSW 14 28025163 missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3858:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3859:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R4556:Erc2 UTSW 14 28302904 missense probably damaging 1.00
R4739:Erc2 UTSW 14 27776881 missense probably damaging 1.00
R4898:Erc2 UTSW 14 27653328 missense probably damaging 1.00
R5068:Erc2 UTSW 14 28302943 missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27652872 missense probably benign 0.40
R5418:Erc2 UTSW 14 27966510 missense probably benign 0.14
R5741:Erc2 UTSW 14 28302869 splice site probably null
R5819:Erc2 UTSW 14 28141369 missense probably damaging 0.97
R5930:Erc2 UTSW 14 27776858 missense probably damaging 0.99
R6073:Erc2 UTSW 14 28011636 missense probably benign 0.00
R6150:Erc2 UTSW 14 28141291 missense probably damaging 0.97
R6182:Erc2 UTSW 14 28317253 missense probably damaging 0.99
R6188:Erc2 UTSW 14 28317251 missense probably damaging 0.96
R6267:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6296:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6730:Erc2 UTSW 14 27898567 missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27898596 missense probably damaging 1.00
R7095:Erc2 UTSW 14 27898593 missense probably damaging 0.99
R7221:Erc2 UTSW 14 27653158 missense probably damaging 0.97
R7365:Erc2 UTSW 14 28040389 missense probably damaging 1.00
R7454:Erc2 UTSW 14 28302991 missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27876204 critical splice donor site probably null
R7784:Erc2 UTSW 14 27898594 missense probably damaging 0.96
R7890:Erc2 UTSW 14 28040341 critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27777208 missense probably damaging 1.00
R8031:Erc2 UTSW 14 28011692 missense probably damaging 0.99
R8206:Erc2 UTSW 14 28303015 splice site probably null
R8273:Erc2 UTSW 14 27777139 missense probably benign 0.41
R8304:Erc2 UTSW 14 27653165 missense probably damaging 0.99
R8387:Erc2 UTSW 14 27653296 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAATTTAATAGACCTTGGGGAGTTG -3'
(R):5'- CCATCAAAGTGGGGTGACAG -3'

Sequencing Primer
(F):5'- GGGGGATTTCTTGTGTTTGAAAGC -3'
(R):5'- TGGGGTGACAGAGGACC -3'
Posted On2014-06-30